GenePrediction:GLEAN_7652 Details

Name: GLEAN_7652
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:711947..711549 (- strand)
Length: 399
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:711947..711755 (- strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_140:711652..711549 (- strand)
Length: 104
>GLEAN_7652 class=GenePrediction position=GCSC_140:711947..711549 (- strand)
ATGGCGTCGGCGCGCGCGACCACGCCACAGAGCACACATCCGGCTCCCACGACCGAAACCGGCAATCCCGACCGGAAGCT
AATCAGAGGACCGCTCCAGCCATCAGCCCACAACTCGCGGCCGTCTTCCTACACTCAATCGCCCAGGCCGATTAATGAAA
TCATGTTCGATCGGCAAAGGCCCGGCCCAGAAGGTGTGTCGATGACCGCCTATTCTCTGTCCCCCCCCCTTTTTTCACTC
CCTTTTCTCTCTTATTCGTCCGTCGCCCTGCTGACCCCTATCTCCTATCTCACAGCGGCCGTGATGGAGATATGTTCCAC
TACGTTGCCACAGCCATTTGTCAATCCCGACGCCCCTCTCACCCACGGATCCACGGCCACCCCCTCCCCGGCCCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62