GenePrediction:GLEAN_7653 Details

Name: GLEAN_7653
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:708579..705050 (- strand)
Length: 3530
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:708579..708383 (- strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_140:708308..707549 (- strand)
Length: 760
Type: CDS
Source: GLEAN
Position: GCSC_140:707468..707394 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_140:707333..706549 (- strand)
Length: 785
Type: CDS
Source: GLEAN
Position: GCSC_140:706492..706286 (- strand)
Length: 207
Type: CDS
Source: GLEAN
Position: GCSC_140:706214..705050 (- strand)
Length: 1165
>GLEAN_7653 class=GenePrediction position=GCSC_140:708579..705050 (- strand)
ATGGCAACAGAGGTACAGACTATGACCACTGTCAAGCGTGCCGACAATCCAAGCAAGGCCCGCAAGAGGGCCCCCAAAGC
GTGCCTCTCATGCCGGGCCCGAAAGGTTCGCTGTGACGTGTCGCAGCGCGGTCGGCCATGCATGAACTGTTACCTCGACA
GTGAGAGTTGTGTGGTCACGGGCCGAGCTTCTAGGCTGTAAGTTCTCCAACGATGACTGTCAATTTGGGGTGCAACGTCC
CAATTCGCTGACTGTCTATCTTTGGGTATAGACGAAAAGCCCAAAAACCAATCGCAAACATATTTACGCCTGCCCTACCA
TCACCCACAGCTTCTGCTGCAGCAAATTCCGGCACGAATGATGCACAGACTTCTTGTCTTCCACCAGATTTTGTTTCCGC
TGGTGAGCTGCACACCGAAGCTGCTCAGTCACCAGGCCAAGAAACCAGCCTGGAGCAGCATGGACACTTGCATATGTGCG
AAGCCGACGAAAGCCAACATGATGAACATCATCACAATCATGCACAAAACACGTCACACACTTCCTCGAAAACTTCCGCA
CCTGGGAACAGCGAGTCACATTCGCCTGAAAATGGCTCCGTGCGGTGCCGTTCGCCATCCAAGGGCGGTGCACACAGCCA
TGATAGCAAGGGCGAGTCAGCATACGAAAACGTACACCGGTCTGAGCCCCACAAGAACTCCAAACACCACCACAACCAGC
CGCAAGAACAGAGTGATCAGGGCCCGGTCAACAAAACTACCGGTGCTGACATTAGCGGATCTGGTGCTGCAGCTGCCGGT
GTCGGAGCCGGCCCGGATCAGCAGCATGCATCGACAGGTGCTGAAAGTATGCTTTGGGCCAGCCAGCATAGCATCTGCAA
TAGAGGCCCGGGAATGACTGCCGATATCACGTACTCCTACTACCCCTTTCTGGCGATCAGCAACCTGTCAGGCGTCCTGC
CACAGGACGTCAACTACCTAGAGACGCAGAGCTGCCTGCGGGTTCCAACAAGAGCCATCCTGGACGAGTTCGTGCAGCAG
TATTTTTCGCGCACGTGCACCCACTACTGCCTCTGTTCAACGAGGGTAACTTTTGGGACCTGTACTGCCAGCAAGGTGCC
GGCCGCGTGTCATCACATGGCATGTCGCTGCTTGTGTTTCAGGCCATGCTTTTCTCAACTTGTAATGTAAGTGGGGGCTT
GGAGAGAAGCGTGACGACAGCGAGAAAACATGTTTTAACATAGCAGTTTATTTCTCGCGAGAGTATTCATGCGTTGGGGT
TCCCTACCATCAGGGTAGCTCGTGCTGCTTTTTATCGGCGGGCGAAGCTGCTGTTTGACTTCGAGACAGAGACGTCGCCA
GCAGCTGTTGCCCAGGCAGCACTCCTTCTCAGCTTCTGGTCGCCGTCAAGCTCACCTGGAACTAAGACGCCTAACACGGC
ATGGCTCTGTACGGCCATCCAGCACGCCAAGCTGGCCGAGGCGCATCGGTACGCCTCGCTGACGGCACCGCGCGATGCCG
GGCGTGCGAATGCACTTAAGAGGCTGTGGTGGTGCTGTGTCCTGCGCGACCGCATCTTGGGTTTGGGCTTGCGTCGCAGC
ATACATATCACGCGCGCACATTTTGACTTTGATGCTAACCCGCCGCTGAACTGCGCCGATCTGGCTGACGAGATCGAGCG
CAGTCCCGTGTACAACCCGGGCACCAAGTCGTGTCTAAACGAGATTCTCGTCCACATGGTCAAGCTCTGCGTTGTGCTGA
CTGATATCCTGGCCCTTGTCTTCCCACTTGATGGCACGCCCGGTTGGGGCCGTCTCACGGCTGAGAGTGACGCCAGCCGC
GTGCGCCAATGCAAAGCCGAGCTGCGCCGCTGGTACAAAGATGCAATGCTCCATTTCCCCATGTTCGGTGGAGCTACGAA
CGGACGAGCTGGAGGCAACACAACGCGCCTTGCCGCTGGTGCTGGCATGGGTCGGGAGTTCTGTCACGATTCTATCATCC
TGTACACCAACTTGATGTACATGTACTATCAGTGAGTGGTCAAATGGCTCCTGATATCCTACCATCCGGCGGCTAACAAG
ACTTTAGCTCTACTCGTGTAGCACTCTGCCATCATGAAGTGCTTCATGTTGCCGTGGCTAATGCTAACAATCCTGGTGGC
ATTCATGACAATCCAATGGCCGTTCCGCCCCTCTACGAGAGCAGGCGCGAGCTCAAGGGTGCCACGTCTGGAGTGACGGA
ATGCCTGAAAGAGTTGATCCGGCTTCGCCTGGCCCGTTGGCTACCCATAAGCGCGTATGTTGTTACCAGCTCTCTTTCTG
TTAGCCCTAGTATATGTTGAATGACCTGTCCTAACATTCTCTCAGCGTCACATGCACGGCCCTGCCGCTCTTCCTGCATA
TCATTGATGTTAAGCTCTCATCAGCGGCGTCGGCTGCTGCTACTGCTGCGGCGCCTGCATCGGCAACGAAGTCAGCAGCT
GCGAAATCGGCCAGTGCAGCCAGCTCAGCGCTGAAGCAGCACCGACTCAACATCCTGATCGAGGCTATGAAGACGTACCA
GCCGCAGTATGATGGTGTTGATTGGATCAGCGAGACCATCCGACACGTTGTCAACATGGCGGAGATCGGCGGGCTAGCCC
AGAACGACAAAATCGGGCAAACACAACAAGCGACGAGCAGCAAGGGCGCCGATGTCTCGGACTGGACAGACATCCTGGCG
TCTAATCCGTCCTGGTACCTCCGCTTGGCTCTTACCATGGACATGGCGCTGAGCAAGAACCGGATTCCAGAGGAGCGCGA
CTTTCCAGTCGGTCTGCGCAGCTTATTTTCCGGCGGCTTTGGTGCTAATGCAAACGCACCGATTGGCAGTGATAGCGGCG
TGGGCAAAGGTCCAACTTCAACAGCGGATGCGTCAATGTTGGACGCTGGGCACCGTGTGAACCTCCACAGCGACATTTCG
GGCCTCTCCTACCCTACAGCTGCAGCCACGGCTGCTCCCGACTTATATACTAAGACAAGTTCTATGATGAATGCTGGCAT
GGAGGGAAGGACCATGGTGGCTGGTGAAGCCAATGGAATGACGGGTAACAGCATCTCCAATGGCGACAATCTGGGGGATG
ACTACTCTTCCGAGTTCCTGATGAGTCCCCACCACCTGGCGATGAGCATGGGTGTGGCCATGGGTATGGACCTCGACATG
GATCTCGACATGGACCTCATCGAGATGGACATGGACATGGGCTTCTCGGCCCTCTCTGCGCCGAGCGTGGCCACGCAGCT
ACAATCGTCGGACGAAGAGATGTCGCCACCAGTTTCATCGACGACTGAGTCCATTGACACAGCCCCAACTTCCGAAGGCG
TTAGTGCGAAGGGAGCAGGAGTGGACATACCCACTCGGGAGGAAGAGGGAGCTGGGATCGAAGACGAGCACGACTGGATT
GAGCAGGCATGGGACGCTGACGGTGGCGAGATGCGCGAGAGCGATCGGGACACGGCAAAGGCGCTGTTGGAAGCGATGAG
CAGTGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62