GenePrediction:GLEAN_7654 Details

Name: GLEAN_7654
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:703011..699857 (- strand)
Length: 3155
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:703011..702101 (- strand)
Length: 911
Type: CDS
Source: GLEAN
Position: GCSC_140:702008..701492 (- strand)
Length: 517
Type: CDS
Source: GLEAN
Position: GCSC_140:701164..699857 (- strand)
Length: 1308
>GLEAN_7654 class=GenePrediction position=GCSC_140:703011..699857 (- strand)
ATGGACCAGTCGAGCTCGCCGGCGGCGACGCTGATGATGCGACCGCGCGTGGCCGTGGCGGTCATCACGGCGACGGCAGC
ACTGTCGATCGGCATCGGGATACTGCTGGAGCACCTGCGGCAGACGCGATGGGGCAAGCGCAGCAGCAGCAACAGCAGTG
GTGGACTGCACAGACGAAACGCGGTGCGACGACCACACGGGACCAGTCGCGAGGACCACCGGCGGACAGACGAGACGGCA
GCGCCGTTTGCGGACGAGAACGAGCGGGTAGACGTGGCCGAGACGGTGGTGGACGACGGCGGCGTGGATGAGCGCTGGCT
CGACGACATGACGCAGGCAGTAGTGCAACGGGCTGGCCAGAACATTGTCAGTCTGCTCTTCCGGGTGTCGGAGGACAACG
CTCGACGCAGCGCGTATGTGCATCGTGGCTGTGCGTGCAACGCGTGTGGGATAGTGCCGATCCGTGGGATTCGTTACCGC
TGTGCCAACTGTGCCGATTTCGACCTCTGCGAGACGTGCGAGTCGCAGGGGCTACACACCAAGACGCACATCTTCTACAA
GGTCAAGATCCCGGCACCGCCGTTTGGCCCTCGTCAGATGCAGCCGGTCTGGTATCCTGGCGATCCCGACAACTGCGCGC
CGTCACTGCCGCGCGGCCTGATGGCACGGCTCTCGCACGAGACCGGCTTCGAGCGGCAGGAGCTCGAGGCTTTTTGGGAG
CAGTGGACGTACATGGCCAACACGGAGTGGCGCGAGGACCCTGATGAGCTCGGACTCGCCATGGATCGCCGGACGTTTGA
GCGCTGTCTCGTGCCGTCGGGCGGCTATCGCCAGGCGGTGCCAAACCTGATCCACGACCGCATGTTTGCCTTTTACGACA
CCAACAACGACGACCTCATCGGCTTCTCCGAGTTTCTGCACGGGCTTTCGTACCGCAAGCGCAAGGACAAGCTGCGCCGC
ATCTTTGACGGCTACGACCCACCGACCGCGATGGCTTTGTCAGCCGCCGCGATTTCCTTCGCTTCTTCCGCGCCTACTTT
GTCCTCTACAAGCAGATGCACAAGGACATCATCGAGGGCCTCGACGACCAGGCCATGAGCACCCCCGAGACTCACCAGCT
GGTGGCTGGCCGCACTCCGCTGAGCAGCCTGTTTGGCCGCGAGGGTCGTGTCCCGCCTGCCGACTTGCGCCGCGTTCTCG
ACGGCAAGCTGCTCAACCGTGCCTCGGGCGAGGTCGTCCTCCGCGACGGCTTTCCACCCGACGTCGTCAGCGAGAGCCGT
CCGGACACGGTGTCGCGCAACGCCATCCTCGAGGGTCTCTTTGCCCGCGCCGAGTTCTTTGGCAGCGGCGATCTGATGGA
CGACCAGCTGTTTGCGTCCGCCTCGGTCGGTAACAGCCATCACCATGGCGGCGACGATGGCCGGGACACGTCTGCGGCCG
CAAACTACTGGGACGCGCTGATGAACCCGCCGACGTCGGTGCAGGAGCTGCCGGCGCTGCTGCTGGGCCGCCGCGACTCG
GTCGCTCTCACCGACGGCATCTATGTCGCCACCGAAGATGACGGGACCGAGGACGGCGAGGAGGAGAGCGTGGATGCGAG
CCGAGACGGCGAGGGTGACGACGAGGACGAGGACGACGGGGAGGGCAATGAGGCAGGCAACACAGAACGTCGCGACAGCG
CGACGCAGACAAGCACAGACGGCGTGGCCACGTCACAAGAAGAGCGGCAGCAGCATCGACAGCATCGACAGCATCGACAG
CATCGACAGCATCGACAGCATCGACAGCATCGGCGCCGTACGCCGCAGCAGGAAGTGGCCCGGAAGGCAGCGTTGGCAGC
GCGGAAGAACCTGCACGAGCGGTGGGTCCGGCGGCAGTTTTACCTGGACGAAGAGGAGGGCGCGACGCCGCCGGTGGACT
GGGACGATGGAGAGGACGTGATTGTGCAGCAGCAACAGCAGCAGCAACGGCAACAGGACGCGCAGGCCAGGAACGCCAAG
ACGCAGCGGTCGCGGTCATCGTCCAAGGTGCGGTTTGCCGAGGACACGGAGGACTACGAGATCCAGTCGACGTCATCGCG
CAGCGTGCCGGAACGATGGGGTGGCATGGAGATTCCCGGGGCCGAGAAGGACGCCGGCCAGGAGATCTTGTACCAGGTGA
TGCAGCAGGCCTTCAACGAGCTGCTGGACATCCTCTTCAAGGAAAAGGAGGACCTGTCGGTTCTGGCTGGACAGACGAAG
AGCGCACGCGAGGAGCATCGGCATCTGTTTGAGGCGATCGACGTAGGCAGGCCAGCCGAAGAGACAGCGGCGACGGGCGG
AGAGGAAGCAGATCCGTTTCTGATGGATCTGCTTGTTCGGAGCGGTTATCAGGTGCTTAAGAAGGAGGAAGAGGTAGTGA
AGGAGGAGGAAGGGGAGAATGAAGAGAAGGAGATTGAAGAGAAGGAGAACGAAGAGAAGGAGAATGGCGAGAAGGAAAAC
GACAGGAAGGAGAATGACGAGAATGACGAAAACGACAGACCAGACAGACCAGAAGCGCCTGCTGACAAATCAGTGACGAT
TCCACTTCTGCACGTCAACGGCTCGGCAGTCGGTCAAGGCAGCGAGCAACCGATCGGCAGAGAGCCAACTTGCAGAGAGC
CGACATACAGAGATCCGACGATGCCGCAGTTCCGACCCAACTCGGCAGCAGACCTGGAGGACAGGGAGGAAGAAGAGCGC
GATGGGCTCTTCGCAGACGCACTCGCCGCTGTCTCGACAGCGGCAACAGTGGCGACCAGTTCAGGCGGACCGTCAACGCC
GACCGCGCACGGCTTTTCGACCCTGTCTGCGGCAGCAACGAGCGAGAGCGACAGCAATGGTGGCAGCAGCAACAGCAGCA
ACAGCAGCCGAAACAGAAGCGGAAACGGAAACGGCAACAGCCGAAACGGCAGAAACGGCCACGACCGAAACGGTACACAC
AGCACGCAGACGCCCATTCCCCAGGCGACGCTGGTCCAGTGGAAGAAGCTGGACCTGGCCGAACAAGAAGCGGCCCAGCG
TGGCGGCTGGGGCAGGCTGAGCTACCCCGAGTTCGAGGCCATCTTCAAGGCCGAGGAGGCGTCTAACAACCGTCTCGACT
ACCTCGGTAGCTGGATCGACTTTTGCATTCCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62