GenePrediction:GLEAN_7655 Details

Name: GLEAN_7655
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:691368..689470 (- strand)
Length: 1899
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:691368..691328 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_140:691272..689790 (- strand)
Length: 1483
Type: CDS
Source: GLEAN
Position: GCSC_140:689730..689470 (- strand)
Length: 261
>GLEAN_7655 class=GenePrediction position=GCSC_140:691368..689470 (- strand)
ATGTTGTCCTCGTTCCTCGGTCTCCAGTACCGGAAGGACTGGTGCGTTGGCCGCGGGCTCCTCTTTCCCCTCCCCCTCTC
GCTGACGTGTGTGCAGCGCCTTCAAGCAGGCCCAGCGGGCTGACCGCATCCGCGCGCTGCCTGCGGCCTACCACGGCGCG
CTGACGGCCGACGACCGCGCTTTGCTCGGCCTGCCGGTCGAGCAGCTGGTGCGCCAGGTGCAGGCCGGCGCGGTCCAGCC
GCAGACGGTGCTACAGACGTACGGCAAGGCAGCGCTGCGGGCGCAGGAGCAGACCAACTGCGTGACCGAGGTGATGATGA
CGGCAGCCGAGGAGTGGCTGGCAGCCAGCAGTAGCAGCGGCGATGCGGCCAGCGGATCCATCAACCTGGCAGGCCCGCTG
GCTGGCATGCCGGTCAGCCTCAAGGACACCATCGTCGTCGGCGGCTTCGACGCGTCAGTCGGCTACAGCAGCTTCACACA
GCAGGTCCAAGCGGCTGATGGCGCTGCCGTGCGGCTGCTCAAAGACGCTGGCGCCGTGCCGTTTGTCAAGACGAACCTGC
CCATCACCCTCCTCAGCTTCGAGTCGACTAACGCGATCTGGGGCCGCACCACAAACCCCCACAATGCTCGCTACTCACCC
GGTGGCTCCTCCGGTGGCGAGGGCGCCCTGCTCGCTCTCGGTGGCAGTCGCATCGGTGTCGGCAGCGATGTCGCCGGCAG
CGTCCGACTGCCCGCCGCCTGGTCTGGCTGCTACAGCCTTCGCTGCTCAACCGGCCGCTGGCCCAAGCTCGGCTTTCGCA
CCAGCATGCCCGGCCAGGAGGGCGTCCCCAGCGTCTATAGCCCCATGGCTCGTACCCTTGCCGATCTCACCTATTTCACC
CGCGCCGTCGTCCAGATGCAGCCGTGGAAATACGATTATTCCGTCCATCCGCTGCCCTGGAAGCCCGACGTCGAACAGGC
TGTCGCTGCCCCCGACAAACTACTCCGCGTCGGCATCCTCACCACCGACGGCGTCGTCGACCCCAGCCCTGCTTGTCGCC
GTGCCCTCGACTCCGTCGCCGACGCCCTTCGCACCGCTGGCCACGACGTCGTCCTCATCCGCGACAGCCCCGCCACCAGT
ACAGATACTGATAAGTCAGCCGATGAGTCAGCACACGTCCCCATGCCCCCTAACATGGAACACGCCCTCAACATTGCCGC
CCAGCTCCTCAATGCCGACGGTTGCCGCACCTTTGAAGTCGCCCGTCGTCCCCACGAGTGGCTTGACAGCGGTGCCAGCC
AGATGCGCCGCCTTGCCGCCCTCCCAGCCCCCCTCCGCTACCTCTACTACCTCTGGGTCCGCTTCGTCCGCCGCGACCCT
GTCTGGGCCCGTCTTGTCCGCAGCTGGGGTCCCAAGTCGGCCTTTGAGAACTGGCAGCTCGTCGCCCAGCGCGAGGCCTA
TCGCGACAGCTGGTTCCACTGGTGGGACAGTGCTGAGCTGGATATCCTCATCACTCCCCCCAATGCCACTCCTGCTCTTC
CTCATGATGCCATGCATGATGCCGTCAGCAGCTGCGGCTACACCTTCTTGTTCAACCTGGTTAGTCTCCTTGTGTTTGTA
TTATGCTCCTTTAGTTGCCGTGTCTAAATGTTGTGCAGCTCGACTACACCACCGGCATCCTCCCCGTCACCCACGTCGAC
AGGACCAAGGACCAGCTGCCCGCCGACTTCTCCCTCAGGAAGCTCAATGGCGTTGCTCAGGGTGCTATGAAGCACTACGA
CGCCGACGCCATGCACGGCCTGCCTGTGGCCGTCCAGGTTGTCGGCAGGCGCCTCGAGGAGGAAAAGGTATTGGCTGCCA
TGAAGAGGGTCGAGGATGCGCTAGGCGACAGCAGGTACAAGCTGCTGGAGCTGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62