GenePrediction:GLEAN_765 Details

Name: GLEAN_765
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1968804..1970810 (+ strand)
Length: 2007
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1968804..1968858 (+ strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_97:1968916..1969153 (+ strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_97:1969202..1969316 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_97:1969378..1969457 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_97:1969517..1970810 (+ strand)
Length: 1294
>GLEAN_765 class=GenePrediction position=GCSC_97:1968804..1970810 (+ strand)
ATGGACGCCTTTTCCGCAGTTAACGGCAAGACATTTGACTACATTGTCGCAGGCGGTCCGTTCCCTGATGTGCTGCGACT
GAGGGGCTCGAAAGCATGCTGACCAGATGCAGGCGGCACCTCGGGATGCATCATTGCCTCCATCTTGGCCCAGCAGCTAC
CAGACTGCAGCGTGCTGGTAGTCGAGGCCGGGCCTGATGACTCAGCAGATCCCGACAACCTGGTGCCTGGACTTACTAAA
CCGAAGTTTATGAGCAAGGAGGGCAACTGGCTGTACAAGACGGCACCGCAGACAGCACTGGGAGGCCGAGAGATCATCTA
CCCTCGCGGACGAGGGCTGGGAGGTTGCTCGTAAGTACCAAAAAAAAGAAGGGAGAAAACAATTTTTGACCCGTTCAGGG
CAAACAACTTTCTCGGCTGGGTCAAAGGTCCCAAGGCTGACTGGGATGCCTGGGCCGCGATGGCCGGTGACCCGTGGTGG
GCCTGGGACAATGTGAAGACGGTGTTCAAGGCCGTAAGTCCTGCTCGGTCTCTGCAGTGCGAAGATGCAGCAGCGAGAAG
ACTAACTCGCATAGATGGAAGACTTTGACTCCCGCTGTCCTGCCGGTATGGAGAAGTATGTGCAGCCGACACCGGGCGTG
CACGGAAAGGGAGGGTAAGGCAGTCCGATTGGCAAACGTGCTCTTTGCGGTCGTGCTGACAGTCTCTGCATAGACCCGTA
GGCGTTTCCTACGGCGCCACCTGGCTGCCGATTGTGCCGTACTGTCTGGACGCGTTTGAGCAGGCCGGATACGAGCGGAA
CCTGGACCACAACGACGGCGACGCGCTGGGCTACTCGGTCGTGCAGTTCTCGGCCCAGGATGGCGTGCGCGTGACCAGCA
CGACGGCCTACCTGAACGAGCAGCGCCGCCAGGCCTTGCCGAACCTGACGATCCTGACGAGCAGCCTGTGCTCCCGCGTG
CTGTTTGAGGACACGAGAGCAGTCGGCGTGGAGATTGTACTGGCGAGAGCGACCACGGCAGCCGAGAAGCAGCAGACGGT
GACGGTATCGTCGCGCTCCGACGTGATCGTGTCCGGGGGAACGTTCCAGTCGGCCCAGCTGCTGCTGCTGTCGGGCGTGG
GTCCGGCAGCCGATTTGGCCAGGCTCGACATTCCGGTAGTGGCAGATTTGGCACCCGTCGGCCAGCACATCCGCGACCAC
TCGGCCTTTGCGTGCGAGTACGTGATTGAGCCGTCCATTGGCGGGCACAACGAGGTGCTGCGGTCACCGGCCAAGCTGGC
AGCCGCCAAGGCCGAGTACGCAGCCTCCAAGACAGGTCCGCTGGCCATCTACGGCGTCAGTGCGGCGGTGTCGTTTCCCC
GGTTGCCGGCCGTGCTCCAGTCAGCCGAGCTCGGCCGTGCCGACACTGCCGTGCAGCAGTTCCTGGCTGAGCCTAGCCGG
CCCAGCACCGAAATTTGGCTGCACTCGGGTCCGCTCTTCTATGATGGACCCTGTCCGCCCGACGCGAACGTGCTCGCGAT
CGAGGGCCTCTGCCAGAACTGCCTCTCCGAGGGCTCGCTCACGTTGCGCAGTCGCGACCCCCGCGACCTCCCCGTCGTCG
ATCCTCACTACGCCGAGCACGAGCTGGACATGCGCGTCGCCATCGAGACCGTGCGCGAGATCCTCCGCGTCGCCAAAACG
CCCGCTCTCGCCGGCATCATCCGTGCGCCCTTGCTGCTGCCCGCCTCCGAGTCCGAGGCCGATATCACCACCTTCGTCCG
CCAGAACCTCAGCCAGGGCTTCCACAGCATGGGCTCCTGTGTCATGGGCCCCAAGGATGACCCGCGCACCGTCGTGACCA
GCGACTTTAGGGTCGTCGGCCTCAGCGGCCTCCGCGTCGCCGATATGAGCGTCTGCCCCGTCCTCACCTGCAACCATACC
CAGGTCAACGCCTACCTCATTGGCATACGCTGTGCAGAGGTCATCGTCGCTGACGCCCTGCGTGCGCCGAAGCTGGCAAG
ACTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62