GenePrediction:GLEAN_767 Details

Name: GLEAN_767
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1985027..1987152 (+ strand)
Length: 2126
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1985027..1985069 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_97:1985300..1986841 (+ strand)
Length: 1542
Type: CDS
Source: GLEAN
Position: GCSC_97:1987019..1987152 (+ strand)
Length: 134
>GLEAN_767 class=GenePrediction position=GCSC_97:1985027..1987152 (+ strand)
ATGTCGGAATTTTCGAATCTCGAGTCTATATTGGCGACTCTCGGTAAGTCAAACTCACACTGTCCTCTAAGCTCCTTATG
GTCTCTCCACGCGTTGCCGGCTTGAAAAGTACAAAGTCCTGCTTGCAAGCCTTTTGACATTCATGTCTGTATTGTGTATA
TGCATCTACTGTTATCTGCATCTGCCCTGATTTCTTCCTGAAGCTCTTCCCAATCCTGAACGTCTTAGAGCCCGTATCTG
ACCATTTATGTGTTTCTTGTTTGAAATCAATAGCTGCGCAAAAGCCGCAAGCCTCGTCGACGCCTCCCCAATCGCAGCAA
CCATCTTACCCCCCGCCGGCGCCCAGCTATCCTGCCCACAGCCAGGCTCCCGGTGTCTCTAGCAGCGCCCCTTATCAGGC
GGCACCAGCAGCGTCATACCAATATCCACAGCCGACATCTAGCGGTAGCCTCGACCTAGGTGCTGCCGTCCAGCCCACGA
CATCAGGAAATGTGAGCATCCAGGAGGCCATTGCCCGGGCCAAGGCACACGCTGCTCAGAATGGTGTCACTCCGTATGAT
CGCCCCATCACATACTCGGCAACTCCACCTGCGACTGCACAGCCCGATGCTAGACGGTACCGCAGCTCTCGCTCTCGGTC
GCCAGCCCCAGCGAGACGGACCGGCGACAGCTACCGCAATGGCAGCAATCCGTACCGGGACGAACGGCGGGATGCCAGCC
ATGATCACGGCGACGAGCGCTCCTTCTCGCCGACGCCACGCGGCAGAGATCACGACCGCTTCTCTCCCCGCGGCGGCAAT
GGTGGCCGGCACCGGTCGCCTGGCCGCGGAGGCGCTGGTGGCGGCGCCGGTGCTGGTGGCGACGACATCACAGAAACGAT
CGAGATCCCAGCCAGTCTCGTGGGCCTGATCATCGGCCGACAGGGCGAGAATCTGAAGCGCGTGGAGAACGACAGCCACT
GCCGCGTTCAATTCCTTGCTGCGGCCAGCCCAGACGAGGAGACGCGCCAGTGCAAGATCACTGGCCCTGGCGCTCAACGC
GTCATTGCCAGGACCGCTATCTACCAAATCATCGAGGACAGCGGTATGAGCTCAGCTCCCCGGGGGACTGGCAGTGACCG
CGGTGCCAGCAGCGTTGGTGGACGTGGCGCTGGTGGTGCCGGTATGGGAGCTGCTGGTGGCGGCGGTACAACACCTCTCA
AGGACGGCGAGGAGTGCGTCCAGATCATGGTTCCGGACCGGACTGTCGGCCTAATCATTGGCCGGGGTGGCGAGACGATT
CGTGACCTGCAGGAGCGCAGTGGCTGCCACATCAACATTGTCGGCGAGGCGAAAAGCGTGAACGGCCTGCGGCCGGTGAA
TCTGATTGGCGCCCGAGCAATGACGAACCAGGCCAAGGAGCTGATCATGGAGATCGTCGATAGCGACACGCGCAACTCCA
ACGGCGGCGGGCCCGGTGGTCCTGGGGGGGCTGGAGGACCCAGCAGTGCTCCCTTCCGAGGCGCAGGAGGTGGTGGCCGG
GAGGGTTTTGGCGGTGCTCCAGGCGGTGGTGGCGCAGGCTTCAGGGGTGGCCCTGGTGGCGGTGGTGGCGGCGACCGCAT
CAACGACTCCATCTTCGTGCCGTCTGAAGCGGTGGGCATGATCATCGGCAAGGGTGGCGAAACAATCCGCGAAATGCAGA
CGCAGACGGGCTGCAAGATCAACGTGTCGCAGACGCCGGGTGCCAACGAGAACGAGCGCGAGATCGGGCTGATTGGCAGT
CTCCAGGCCATCGAGATGGCAAAGCTGGCCATCGAGGAGAAGGTGGAGGCCGTTCGTCAGAAGAACAGCGGTGGTGGCGG
TGGTGGTGGCCGCGGTCGTGGAGGTGGCGGAGGCGGCTACCAGCAGCGCGACTATGACAACTCGAGCTATGGCAACGGCA
GTGGTCGTGGTGCCGGTCGTGGCGCTGGTGGTGGCGGTGGTGTTCCTGCGAGCTATGCGCCGCCTCAACAAGGCGCCATG
TCTGGCAGCGACGACCCGAACGCGGATCCCTACGCTCCTTACGGCGGTTACGCGGCCTACGTGGCCATGTGGTATCAAGC
ACTGCAGCAACAGCAGGCAGGCGGTGCCCCGGGCGACGGTGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62