GenePrediction:GLEAN_7681 Details

Name: GLEAN_7681
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:550416..549187 (- strand)
Length: 1230
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:550416..550317 (- strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_140:550263..549416 (- strand)
Length: 848
Type: CDS
Source: GLEAN
Position: GCSC_140:549342..549187 (- strand)
Length: 156
>GLEAN_7681 class=GenePrediction position=GCSC_140:550416..549187 (- strand)
ATGCCTTTGCTTGCAGATGGTCCTGTTCGCGTTGCGGTCCTGTACCAAGCGCTGGAGCCTCCGATCATCAATGGGGAGAA
GAAGCCGATGAAGCCTGGTGGTATGTCGAGACGCCACATCTCTAGGCTACAGACTGCAGACTAACACACACAGGCTACCA
AGACTCAGGTGCCGACATTGCCTTTGCCCTTCAGGGCAGCGAGGGCATTGACGTGGTGACGCCCCGTGACGATCCAGATC
CGGCTGACCATCACGGTTGGGCCTTTCCGGACACGGAAGAGGGCATCCTGGAGGCACTGAGCCGAGGAGCAACGCACGTG
TGGGCCAACACGGTGCTGTTTGCATCGCACCCTCTGCAGACATCGGCGGCCATCGGGGCGTACCAGGACCGCGTCCGGGT
AATCGGTCAGGGCCCGCTAGCCGTCGAGCGCTACGATGACAAGGACTACATCAACAGGCTGCTGCGCGGCCTCGGCGGCT
TCACGCTGCCGCGCTCGTGGTCGTTGTCGGCTACGACAGACCCAGCAGCCGTGCACGAGCTGCCGGGCATCGCCTATTCC
GTTGTGGGTAAGCCAGCGCGCGGCCGTGGCAGCTATGGCGTCAAGGTGTGCCACACGGCCGACGAGCTGCAGGACCACGT
GCGCGAACTGCAGAGCGAGACCATGCATGTTCTCATCGAGCAGTTCCTCGCCGGCGAGGAGGTCACGGTGACGGTCATGC
CGCCCGCGGTCGCCGGCAAGACTGACTATTGGGCACTGCCCGTGGTCACCCGGTTCGACCATGAAGACGGCATCGCGCCC
TCCAACGGGTCTGTGGCCGTGTCGACCAACTCGCGCGCCGTTTCCGACAGCGACAAGGATCCGCTCTACCGCGCGCTCAT
GCGCGAGTGCGAGGCCGTTGCTCGTGCCTTGGGCACCACTGCACCCATCCGCGTGGATGCCCGTCGTCATCGTGATGCTG
CCTCGTCCAAGTTTGCCCTCTTGGACGTCAACACAAAGCCGGTACGTCTGTCTGCATCGGCAGTTGTATAGTCTCCCTCT
TTCGTCATAGCCCTCGCTCATGCATCTTCTACAGAATATGACAGGCCCCGGGCGTCCTGGTAGAGATGACCAGGCCTGCC
TCACGCTCCTGGCTGCCGAAGCCCTCGGATGGGAGTATAGAGAGCTTCTGGAGCGGATCCTTCGCACGGCCAGTGTTCTG
CGCGATCTCAGACAGGTTGTGCCCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62