GenePrediction:GLEAN_7682 Details

Name: GLEAN_7682
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:542161..541196 (- strand)
Length: 966
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:542161..542075 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_140:541791..541635 (- strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_140:541563..541196 (- strand)
Length: 368
>GLEAN_7682 class=GenePrediction position=GCSC_140:542161..541196 (- strand)
ATGGGTGCCCTCAAGTACGTCGAAGAGCTCCAGAAGCGCAAGCAGTCGGATGTGCTGCGTTTCCTCCTCCGTGTCCGCTG
CTGGGAAGTACGTTGAACCGAATTTTCAATCCGAAGAACAATACCCGAAGACGAATGGCAGAGGCCGAGTGTCGTTGGAG
TGCATCGAGGACCAGGAAGATAAAACTTGAAGTGAGGGGAAAAAGACAGAACCAAAGAGAAAAGTTTTTGCCAGCTTTTC
TGTGCGACCTGCCTTTCATCCTCGCTCGGGTCTTCTTTCTCCCTGGCTCTCCCTGCTCCTCCACGACGCCGTCCATCACA
AACACTCGTTGATCAAGAACTTTTGTGCTGAGAGTGTTTTTTGTGAATAGTACCGCCAGCTGAACGTCATCCACCGCGCT
TCCCGCCCGTCGCGCCCCGACAAGGCCCGCCGCCTCGGATACAAGGCCAAGCAGGGCTATGTCATCTACCGCGCGCGCGT
TCGCCGCGGTGGCCGCAAGAAGCCGGTTGCCAAGGGTGCCACTTTCGGTAGGTTAACGATTGATGTTCCCCCACCGTCTC
GCCCGATCGCTTGCTCACCTTCTCTCCTCTCTCCACAGGCAAGCCTACCAACCAGGGTGTGAACCAGCTCAAGTACCAGC
GCTCGCTCAAGTCCACCGCCGAGGAGCGTGTTGGCCGCCGCTGCGGTAACCTGCGCGTCCTGAACTCGTACTGGGTCAAC
CAGGACTCCACGTACAAGTACTACGAGGTCATTCTCGTCGACCCCAACCACGCCGCAATTCGCCGCGATCCTCGCATCAA
CTGGATCGTCAACCCGGTGCACAAGCACCGCGAGTCGCGTGGCCTTACCGCCACCGGCAAGAAGTCTCGCGGCCTCAACA
AGGGTCACAAGTTCAACAAGACCCGTGCTGGCCGTCGCAAGACTTGGAAGCGCCACAACACTCTGTCCCTGTGGCGCTAC
CGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62