GenePrediction:GLEAN_7684 Details

Name: GLEAN_7684
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:529298..526436 (- strand)
Length: 2863
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:529298..529157 (- strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_140:529097..528386 (- strand)
Length: 712
Type: CDS
Source: GLEAN
Position: GCSC_140:528333..527659 (- strand)
Length: 675
Type: CDS
Source: GLEAN
Position: GCSC_140:527598..527104 (- strand)
Length: 495
Type: CDS
Source: GLEAN
Position: GCSC_140:526979..526436 (- strand)
Length: 544
>GLEAN_7684 class=GenePrediction position=GCSC_140:529298..526436 (- strand)
ATGGCGTCTATCAAAGCTGGCTGGAGCTCGCTGCTCATCCTCGTCCTCGTCCTGACCTTTATGCCCGGCAGGGCTGCAGC
CTTTGGAGCTGGCAACATTCCCTCCATTGCGCAGGTCGAAGGCCACAATTGGAGACATGGAGGTATGTTTCGTCATCGTC
CTAATAGTTTGTTTCGTGGCTGATATTTGTATGCTTTCCAGACATTGAGGACATGCTCAAGACCATCGCCTTCCTCCACG
GCAAGAAATGGACGACGATGCTCGTGCAGCGGACGTATTTTGGCAACTGGCTTCGTGACTACTCGCAGGCCGTCGATGTT
GGCAGCCTCAAGGGCGTCAATGGAGCGACGATCCGCATTCTTGTCTGGGTGCTGTCATTTCTTGCCTTCGGCTATGCCAC
GGAGGAGTTTGAGGTGACCGAGGAACGCCTTGGCTGCTACCGTCCCGAAGAGCACATTGACAACCCCAAGGGTTATGCGG
ACGGCGAGGATGCGCGCCAGTATGACTCGCGTCTCCGCGGACCCATCGACCCGCAGGAGCTGGCCATCGATCCGGACACG
GGCATGAAGAACTACATTGCCAACGAGCGGGGCGGCTGGGCCACCAGTGCGGGCTACCTCCGCTTCAGCTTTGCCCGGAG
CATCCACTTTGGCCGCACGTATCTGCACGGCCAAGCATCGGGAAAAGAGGCTGATCTCTGTGAGGCTCTGCGGTGTCTCG
GCCAGTCTCTGCACTGCATGGAGGATTTCAGTGCTCATAGCAACTATTGCGAGTTGGCTCTCATCGAGATGGGCTACAGC
GAGGTGTTTCCGCACTGCGGTGTCAACTCGCAGATCAACTTGCGGGGCAGACGGGTATATCCCATTGTGACAGGCACATT
TGGCGGCGTCGACTTCCTGCACTCGGTTATCGGGTAGGTGGCCATCGCATCTTTCCGTTTTATTCAGACGCTGACCAGCA
CGCAGTGAAGCAAACGACCACTTCACACAGTCGGAGGTGGACGAAGTGGACATTGCCCTTAAGAACGCCGAGCAGCTGAA
TCGGTCAGGAAGTCTGAGTGGCGGTGGCAACGGCACCCGAGGTCTGTTTGGGTCGTCGTCAGGGGACCGGGGTGACTTTA
TGTCGCTCATCTCGCAGCTGCCGGGCGTCGGAGGCGGATTTGTGGCTGAGGCCAGCCGGCTGCAGTCGATGGCGGCAGCA
CAGGAGGAAGAGAACACGCGGGCGGCCGGCAACGTGAACCAGGTGCCGGGCATGAGCACCAACTTCGACCCGGTGTCGAC
GGCGCGCAAGATCTACCCGATCCTGGAGTTCCGCGACAAGATAGTCAGGTCGATCAACAACACGATCTCCAAGATCCCGG
GGCTAGAATCGCTGATCGAGAAGATCAGCGAGAGGCTGTCAGCGTTTGTGCTAGGCCTCCTCGCGCCATTCATACGGCCG
ATCATCAACCAGTGCACCAAGGTGCTGAAGGACGGGTCGTCGGGGGTGATCAGTGCGAGTGCAAACACGCAGCTGGAGCC
GTGGACGGACGCGCAGTGCACCGACCCGACGCACTCGATGCTGTCCAAGGACCACTTTACCAACGTGCTCAACTCGTGTG
CCGGCCGGGTGGCTGCGACGGTGCTTCAGTACGCAGTTCCGTAAGTGCGCGTTGTCAATGTGCTGATGCCGGTGTGTGTG
GTTGCTAACGGGGTTCACAGACGGATCCTTTATGCGTGGGACAACCCGAATGTACCGGTAGACGAGGTGGCCAACGACAT
CATCCGAGCGTTTCACCACCCAGCAATACGTGACGATCGGATCCCGATCCAGCAGCAGATGTTTGAGACGGTGCGGCGGT
GGGTGGGCGAGTACCCGCGCCAGCACGAGCTCAACCACCTGCTGTCGTCGCAGTCGGTCAAGACGGGCAAGAACCACATT
GTGAACGGGGTCAGCGGAGGTGGAAGCGGCAGCGCTGTTGGCGGGCACTCTCACGCAGGCGGACACTCACACGGCGGCGG
TGGTGGGTGGCAGAGCACGCTGGGAAACCTGGGCAACATGGGCAACATGAGCAACAGCCAGATGGCAAACACGATCTTTT
CGCAGTTCAAGTCGCGCGACCTCGACGCGATGGACGGGCGATCGGGCAACATGTCGGACAACTACATGTCGACATCACCG
GCGCCCAACCAGGCGTCTTCATCTTCTTCGCCTTCGTATGGATACAGCCATGGCGGTGTTGGTGGCTACAATGGCAGCGG
CAGCAGCGGCGGCAACGGTGGACAGTACTCGTCGACGCGGCTGACGGGAGGAGCAGCCGACTCATATCTTCGGCCACAGG
CAGCGCAGACATCATATGGATCTCCTGCAAGCCCATCCGGCAGTTACCGTGCTAGTGGGGGAGGAGGAGGGGGCTACGGC
GGAGGTTATGGAGGTGGTGGAGGTGGTGGAGGGGAGTATGGGTCAGGAGGGGGCAGCCAGGGATATAACTCCGGAGGGGT
TCAGCAAGGCGGATACGGCTCTGGAGGGCCAGTCGGAGGTGGATATGGAGCAGCTGGAGGCGGTGGATATGGTGGATATG
GTGGAGGCAGAGGATACGAGACAGGTGGCGGCAGTGGCCCTCTCGGGCCTCCCGGACCTCCAGGAGGACCAGGCCCTTCC
TACCAGCAGCAAGGCTATTATGGCGGACCGCAGCAGCAGCAGCAGCAGGGCTACGGCAACTTTTACGGGGGACCACCTCC
TTGGGGCGGCAACGGACCGCCACCACCAGTGCCACCTGGCTTCGGCTACGGAGGTCCACCGCCGATGCCGCCGTATGGCG
CACCACCTCCTCAGGGATGGGGACCGCCGCGGTATTGAGGGAGAAACGCGAAGGAAGAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62