GenePrediction:GLEAN_7688 Details

Name: GLEAN_7688
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:513626..511283 (- strand)
Length: 2344
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:513626..513604 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_140:513218..513086 (- strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_140:512951..512733 (- strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_140:512594..512288 (- strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_140:512241..511448 (- strand)
Length: 794
Type: CDS
Source: GLEAN
Position: GCSC_140:511387..511283 (- strand)
Length: 105
>GLEAN_7688 class=GenePrediction position=GCSC_140:513626..511283 (- strand)
ATGCCCGACATTGTGCAGCAGTGGTGAGCATGGAGAAATTCCTCCTCACTGTTCCTTCCCGCCACGCTGCTCGCCCGCTG
CCCATTCCCTACCCCTCTTTCCCTTTCCGGCTCCCTGCCCTTTTATCACAATCGAACAGGACCAGACGTATGTAAATGCA
GAAGGGCGTTTTCATCGTAAGATGATCCAATTCCGGCTTCCCCATCTCTCCCTCGTTCTCTCCTACGTCACATTATCCGC
CTCTGTCCTCTTTACTCCGTACCAAACTGGCCGTTCCTGTTTTCCTCTTTTCTCCACTGTGCCCAAGGCACACTTTACGA
AACCCAACCCGGCTTCCCACTGCGCTTTTCAGAGCTGCGAATGAAGGAAAAGACGGACCTAGTCTCGATTTCTGTTTTAG
TTTTTTAGTCTGGTCGCCATAGCATCGCCTGCTCAAGACGACGCCGCGACCATGGAGCGTCTACCAGTCAAAGCCATCGA
TTTTGATGAGCGATTTGCCATGCTACGGTACTACAATGACAACAGTAGCAGCCTCATCGAGGTATACAGCCTTGTGCCCC
CCTTTCCGTCGGCTGCCTGCGTGCTTGTGCGCCTGCACGGCCTGTCTGCCGTCGACTCATGTCGACGACCTGCCCTGCTG
TTTCTCCCCCACCTGCTCACCTGTCTGCTGCCTAGGACTTGATCACTTACTGCAAGCGGCGCGAGGCGTCATTTATGATG
GAGGAGAGCCAGCTGCGCAAAGATCTGCACGATGCCGAGCTCGACCTGAAGCATGCCACCAAGTCACGGCGCGACCTCCA
GGAGGAACTCCGACTGCGCGATGTAGCCATCGAAGAGCTGCAGAAGAGCAATGATATATTAAAGGTGCGAACGGCTGGCG
ACGCCCACACGACTGTGAGCAGCAGCTGACACGGTCCAGAACAGCAACCCTTACGTGAGCATATTGATAGACGGTGACGG
TTTATTGGTACGTGGTCCCGGTCTTTCCGGCGTGTTGGTCGAGGCCTCTCTCTCTTGTTCTAACCCGGCCAGTTCAAAGA
AGAATTTATCAAGCAAGGCATCGAGGGCGGCAAGAAGGCGGCCTCGGCGCTGCGTGCGGCCATTGCGTCGGTAGCCAAGC
GAAATATCAACGACCAGCCCGACAATATTGAGGTGGTGGCCACGGTGTACGCAAATCTGGCCGGGCTGGCGGGCGCGATG
CGGCGGGCGGGCTGGCTGGCCAGCACGGACCTGATGCGGGACTTTACACAGGGATTTACGCAGACAAAGGCCTCGTTTGA
CTTTATCGACGTCGGTTACGGCAAGGAGAGGGCCGACTCCAAAATTAGAGGCAAGCATGGTGTGACCGTTCGGCCGTGTG
ACTTATACCCATCTAACACTTGCAGGAGCTGCAAGCTGGCATCTTAAGAACCCCAACTGCAAGATGTTGGCGCTGGGCAT
ATCGCACGACTCGGGCTATGCGCCGTTCCTCGACGAGATTATCAGCGTGGGCCAGACGCGCGACCGGATCGTCATCCTGG
AAGGCTCGCCGACGGTGCCAGAGCTGGTGGCGGCCAAGGTGGCGATCCACAAGCTGACCGCCACGGTCTTCCATAATGAG
AAGCTGGTAGCGATAGAGCGAACGGTGGCTACGAGCGTGCAGAGACCGGCAGCCGCAGCTGCAGTATCGGTCGAGCAAGG
CCGACGGGACAGTTCGTCGTCTTCGTCGGCAGCCCAGGCGACACCGCAATCGACACCACCGGCACCGGCTACAATTCCGA
CAACAGTGCCGCCTTCTTACACGACCAGGACGACGGCGACACCCAAGGCATCGCCGCCACCGAAGCTGGTGTTCCCGTCG
CAGACAGCGAAGCAGCTGCAGCAGCGCGAGGCAGCAGCAGCGGCGACGGCAATGGCAGCCAAACGACAGGCACAGGCGCA
GTGGAATCCGGGGCCGCGTGGGCTGGACTCGCCGATTACATACAGCATGGCGGTGGTGGAGTCGGTGCGGATGCGACCAC
ACAAGCTGTGCAACAAGTTTGTGCTGCTGCGGTGGTGTCCCAAGGGCGACAGCTGTCCGTACGTGCACCCGACCAAGCCG
TCGGCTGACGAGGTGGCGGCGCTGACGTACATGAGCCGTGTCAGCCCGTGTACCAGCGGCCAGGACTGCGATGTGGACGA
CTGCATCTACGGGCATCACGTATGTTTCTGTCTTGTTGCCCCAACCCTTGTCTTTGTTGCTTTTATGCTCACAATACAGT
GTCCGAGCGTGCAAGACGGTTACTGCATGCACCCTTACTGCAAGTTTGAGGAACACGAGCATCCGCCTCATACAAAGTTT
CGCAGCTACAGCAGCCGCGATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62