GenePrediction:GLEAN_768 Details

Name: GLEAN_768
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1990492..1993087 (+ strand)
Length: 2596
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1990492..1991313 (+ strand)
Length: 822
Type: CDS
Source: GLEAN
Position: GCSC_97:1991454..1991557 (+ strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_97:1991737..1993087 (+ strand)
Length: 1351
>GLEAN_768 class=GenePrediction position=GCSC_97:1990492..1993087 (+ strand)
ATGGCAAACACAAATCAGAACACGCCTGTCACCCGCCGGACAAGATATCTGGGATCCACGCCGTATTGTCCGCTGACTTC
GTCATCATGGGACTCTGGGTATGGCTCCAACATCACCACTCCTGAACAGCCTTCAGTCCCCCGGAGCCTCCCCGATGTCA
GCCCATATGCCTTGGACGGAAACAGTCCGGATATTCCCGACCTACTTCACGAAGAAGGTGACGAAGACCTTTTTTTCTTA
ACACCGACCACACCAACAAAGAACGCCGGTCGTTCAGACAGTTGCCGAAACGAGAAGGTCGCAGCCAACATTCCCCATCC
ACCGCGTGGTCACTTCCGTTCCAGCCTGTCTTCTGTCTTCTTTTCGACACCGCCGCCCAAATTTGGTCTGCCTCCCAGGC
ACGAGTCCGAAGTCTCAAGTATAAAAAATACTTTCCCGTCTACGCGCCGTCCTGACCGATTTGTTCACCCGCGAGACACG
AACAGCAACCCGCAGCCACTTTCCGAAAGATTTCATGTCACGAACTTCCCCGACGACCTGACTCCTGCAGAAAGACTTCT
CCGCCACAGCAATATCTCTGCAGATGTATTCTCACCAGCACAGCCCCGCTTCAACCCTGCGCCTACCAATGCAGACGGCC
GGCAGGCGCTCCAACATGAGGCAGGAATATTAACTCAGACAAGAGCTAGGACTACTCTGGGCTCGGTCGACCATAACAGC
GAACTCGACTCCGCTGATGAACTTCCCAGCGACGGATCAGTCTGGGCTCTGGGTACCATTCCACCTATCATCGGTGCCGT
TGACGACGGACGTGGAAACTTCGTACAAACTGGTACAAACGCCCCGTACTTTACCTCCCAGTTTGTATTTGGGGCACGAC
AGCCAGATGACGAGCATAAACACAGGGGTCGACTTGCCGCCGCCTTGGACATTGATCTTGCCTCCAAACTTCTCAGCTGT
AGCATTGGCCGGAAAATGCAACCACATACGTGGCAACACAAGATTGTTGGATCGAAGAAGACGGCATGGAATGGCACAAC
CTGGGCGAGACAAGGGCCAATGTCACGTAAGTACTAAGTGCTCAATATCCCGCGAGTGAAGTTATCTTATTCACTTTTCT
ATGTGGTACAAGAAATATCGAGGCAAGACTGTGCAACAAAACTGCGACCTCTACGGTTAGTACCGATCTGACATTGTTCC
TTTCCATTGCTGTGTGCTGACCGCTTACTGATCGTTACTCGCTAGAATCCTCTCTGCACCTGATTTGCGGGATGACTTCT
ATTGCTCTGTGCTGGCCTTCACGCCAACTTGCGATACTATTGCCGTCGGTCTGGGAGATTTACTCTATCGTTGGACGGAG
GAAGACGGTGCAAAGCTTCTTAACGGATCCCGTGATGGTAGTTCCTGGCTCACGTCTCTGGCCTTCTCTTCCGCACAGGG
TGGAAAGAGTATCTTGGCATTTGGGCGCTCGAACAACATGCTTGGCTTGCTGTCCATGTATGAGTCTGGGGTCTCACGGA
TGGTCATACAAGAGAGCGCGCCAATTTCTTGTCTGAGCTGGCGCCCAACGTGCACGACGCGCCCATCCAAGAGCCCGCAC
AAGACCGGCTCCCTTGTCCAAACGGAAGATCTATTGGTCGGTGATGATATTGGTAATGTGCAGTATTATGTCGTCGAATG
GCCTGATACATGGGAGGTCGAGAATGACAACTGGAGGGGCGAAATGACGCTGGTGGCCAGGATCTCGGTCCATTATCAGC
AAATTTGCGGGCTTGCATGGACTGTTGATGGCCAGTCTTTTGCGACTGGGGGCAACGACAACATGTGCAAATTTTTCCAT
GCCGATGATGTTCTACCGAGATCCCATCGTCCTGGAAGTACTGGGAATGTGTCAGTCGGACTCCCACAGGGACAGACTCT
CCTCCAAAACGAAGGTAGCCGAATGAAAGCTGTCCTCCCTGGTGGTAGTCAGATTCGAGAGCGGGTTCTCAGCGAGAAAT
ATGTGCGCCGGATCGGTCCGGGGGCTGAAAGTTGGCGCTGGGAACATGGAGCTGCCGTCAAGGCAATTGCCTTCTGCCCG
TGGCAGGAAGGCCTTGTTGCAACAGGTGGTGGTTCCAACGACAAATGCATTCACTTTTTCCACACAACATCAGGCGCTGC
GCTTGCGACGATTTTTGTGTCTTCCCAGGTCACAAGCCTCATCTGGAGCAGCAGCCGTCGAGAAATTGCGGCCACATTTG
GGTTTGTGCACCCTGGACACGCAGTTCGAATCGCGGTCTATTCGTGGCCAGACTGCAAGCAGGTGAACACGATCGAATGG
GAGAGCGAGCACCGAGCTCTGTACGGAATCTCGTGCGCGAAAGGGCCCTACTATGTTCCCAAACCGGAACTCCCCAACGA
TAAACGCCATGACAGCAAAAGCCGCACGCTGAAGGAAGGCTGTATTGCAGTGGCTGCGAGTGACGGTAGCATCAAATTCT
ACGAGCTCTGGCCCTCAGGCGACAAGCCTGCAACGGGAGGCGTGGGCATGCTCGGGGGCAGCGACATTCTGGAAGATCTT
GAGGGGATTCAGAAAGAGGGCGACATTATTCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62