GenePrediction:GLEAN_7690 Details

Name: GLEAN_7690
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:502836..500904 (- strand)
Length: 1933
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:502836..501079 (- strand)
Length: 1758
Type: CDS
Source: GLEAN
Position: GCSC_140:501020..500904 (- strand)
Length: 117
>GLEAN_7690 class=GenePrediction position=GCSC_140:502836..500904 (- strand)
ATGTCGAAACGCGTCAAGGATAAAACCGAAAGCGGTAGCCAAAGCTCCAACAGTCAACCTGTTCGTCAACAGACTCACCA
GCCTGACGGCGCTTTTCCAACAACTTCCCATCCTCCGACAATCCCCATGTTTGCAGTTCCGCCTCAACACTTCTACCCTC
AATACCCTGCTTCTATTTCACAGATACCCATGATGCCCTTTCCTCTGGGGGTCGGCCTCTCTGGAGGCCTTCATTTTCCC
CAGCACTCGGCCACTTCGGGAACCGCTATACGTACCTCGCAAACAAACGCTTTCAAATCCTCTCAGGGGAATGCGGAAGG
TGACGCAGAAGAGAATGAGCTGTCTGAGGCAAAGACAACTGCTGCTGAAAAAACGGCCGAGAAGGTGACAGCCGATCAGT
TTGACCACATGAAGCCGTTTATGATCAATGGCCAGGTCATGTACCCTTTTCCAGCAGCTGCCTTTCCTCAGCCTGTTTCT
TCAAGCTCCCAATCTCAATACATGCCACCCGGATTCATTGGCCATTCCGGGTTTCCTATTGCCGCCTTTCCGAATGCAAT
GATCAATCCCTCCATGAGCCACATGTTTCCCGCTACTATGAGCTACCACGCGTTCCAGGGACCTACACATCTGCCACCGT
CAACGATGAACTTGACCGGCGCACCACAGAGAGTTGATGCTACATCGCGGGTGCCATCATCTGGAAGCATACGCCCTCCG
TCGGCTCCCCCTATCTCGTCGATCCGCCCGAGCGACATCAGCAGAAAACAGATTGATTTACTCCGTAACTCATTGAAGTA
TCATGAAGACCAGCTCCACTACAACAAGCACCAGATCGACGAGAAGGAAATGGAGAGGACGATCGACATGCTCCAGTCTC
AGATTGATAAATTTGAAAGCCTTAACAAAAGCCAGCTTTTGTTCGAGGAACTTCACTATCCCAGGAAAGACAGCAGGACT
GACGAAGCGTCACGTCAAGCCTCTCAAAGCTCAGACAAGACATACAATACTGGGGCCAGTTCGAGGCAAGTGTCCAGTAG
TACCAGGAGATCTGACAGTGGTAGCCAGCAGCCTCCAAATTTATCCAGGAGGAGAAACGAGGCGTGCTTCAGTTTCGACC
CAGTCGAACACCCTGTTCAGTTTGCAGATCCTATCAAAAAATCTACGCTCCCTACTGGTGCAGCTCTTGCTCCGCCTTTT
GAGCCGCGAACTGCCATGTCCAGTGGAAGAGACTGCGTTATGAATGCGCGAAATCTTGGTAGCAATGGCCCTCAATACAT
CTATCAACAAGATAGCCCAACAGTTAATTCTCGAACTGCAGAGTGCCGCACGAGCGCTGACCAGAATAATTATTCCTCCT
CTCTTCCAGCAGAGAAGCAGACCAAGCTGGGGAGACCCTACCTCGTCGGTATGCTTCCAGCAGGCATGGATGTTCGGAGC
GCACGAGGCAGCGATTTTGTTTACGAGAGGGAACTAAATGATGATGAAACTCGAGCTCGCTACCTCTACTGGGGCAAGGC
ACCGCAGTTCATTCGCGAGGGGCTTCCAAAATTTGATGGAAAGGACTTCTACCCTCCGGCTACAACGCGAGATATACCCG
ACGACGATGGTGTATGCAGCGTTCCAGGTCGAAGCATTCCCATTGGAGTCCCTGAGGTTGACTATGGCTTCGAGGCCTTT
CCAAAGAACCCCGAGTCCCACCATCTATTGACACCCGGCTTTGTGGTGAGATCGCGGAAGGGTGTCAAGGTGACTTTGGT
AAGAAAACCCACCCACAAGCACCTATGTGGCATTTGTTGACCCAACTGTCTTTCAGAAACGCCCCAAGGAGGAAAATACG
GACAGATCTCTACGGCAAGACGGCTGCTCAAAGACGGTCGGCGCCAACCATTGTGCTTCAGATAGCAAGAACGTGGATGG
TCAAGCAAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62