GenePrediction:GLEAN_769 Details

Name: GLEAN_769
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1996042..1997052 (+ strand)
Length: 1011
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1996042..1997052 (+ strand)
Length: 1011
>GLEAN_769 class=GenePrediction position=GCSC_97:1996042..1997052 (+ strand)
ATGGCCCCTTCTGCTGTTGCTGTTGAGGAGGTCGGCCAAGCCCCGATTGTTGTGAAGGCTCTTGACGATGCTTCCGCCTC
GTCGGCCACGGAAGCGGCCACCTGGATGCAGAAGCCGCTGGGCCCAGAGGTGACGGCACTCATGGGCCACTGGGACGATG
GGTTTGGCTTTGCGCCGATCCGTGAGAGCCAGGTGTCACGGGCCATGACGCGGCGCTACTTCCAGGACCTGGACAGCTAT
GCTGAGTCGGACATTGTCATCATCGGGGCCGGTTCGTGCGGGCTCAGCGCCGCGTACACGCTGGCCAAGCTGCGGCCAGA
TCTGCGCATCGCCATCCTGGAGGCGGGTGTGGCGCCAGGCGGCGGAGCCTGGCTGGGCGGTCAGCTGTTCTCGGCCATGG
TGATGCGCAAGCCGGCTGACGTCTTTCTGCGCGAGGTCGGCGTGGCCTACGAGGATGAGGGCGACTTTGTTGTCGTGCGC
CACGCGGCCATCTTCACGTCCACGGTCCTGTCCAAGGTGCTGCAATTTCCCAATGTGAAGCTGTTCAACGCGACGGCCGT
CGAAGATCTGATTACGCGCAAGACCGACGGAGATGACAAGCATGCAGTCCGCATCGCCGGCGTCGTTACCAACTGGACGC
TCGTGTCGCTGCACCACGACGACCAGTCGTGCATGGACCCCAACACGATCAACGCACCCGTGGTCATCTCGACCACCGGC
CACGATGGCCCCATGGGCGCTTTCTCCGTCAAGCGACTCGTCAGCATGCAGGCCCTGGACCGTCTTGGCGGCATGCGTGG
CCTCGACATGCAGATGGCCGAGGACGCCATCGTGCGTAACACCCGCGAGGTCGTCCCCGGCCTTATCGTCGGCGGCATGG
AGCTGTCCGAGGTCGACGGGGCCAACCGCATGGGCCCAACATTTGGCGCCATGGCCCTCAGCGGCGTGAAGGCCGCCGAG
GAGGCCCTCAAGGTCTTTGATCTGCGCAAGAAGCAGAATGCCACCTATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62