GenePrediction:GLEAN_770 Details

Name: GLEAN_770
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2001070..2002591 (+ strand)
Length: 1522
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2001070..2001175 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_97:2001261..2001850 (+ strand)
Length: 590
Type: CDS
Source: GLEAN
Position: GCSC_97:2001901..2002014 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_97:2002070..2002591 (+ strand)
Length: 522
>GLEAN_770 class=GenePrediction position=GCSC_97:2001070..2002591 (+ strand)
ATGGCACGTGGAACTAACGGCCTGGGCGTCCAGGTCGAGGACGTCAAAGTATGCGTGGTAATGGTCGGGCTGCCCGCTCG
CGGGAAGAGCTTCATTGCCCAGAAAGGTGCGTCATTCATTACGAGTCCGAGCTTTGAGGGCGCTGGCAGGGACAGGGCTA
CGAATTGGGACTCAAACTCACACATTTACAGCCCAGCGCTACCTGCAGTGGCTTTCGATCCCGGCTCAGACCTTCAATGT
CGGCAATTACCGCCGCAAGGATGCGGCGCAACCGCCGGCTGACTTTTTCGATACTAACAACTCCGAGGGGGAGCGGAAGC
GCCGCGCTGCAGCCGAAGCAGCTGTGGCCGACATGCTCAAGTGGTTCCGTGCCGGCGGTGTCGTCGGCATCTTGGATGCG
ACCAATTCTACTAAGGAGCGCCGCAAATGGGTCATTGATACTTGCACGGCCGCCGGTATCGAAACGCTCTTTGTCGAGAG
CAAGTGCGACAACGAAGACCTGATCATGGCCAACATCCGCGACGTCAAGACGACCAGCCCCGACTACAAGGGCCAAGATC
CGGAGCAGGCTGCCCTCGACTTCCGCAACCGCATCCGCAACTACGAGAAGGTTTACAAGACGATCAACGAGGACGGCGAC
GAAGAAGATCTCACCTACCTCAAGATTATGGACGTCGGCAGCCGTGTCATCATCAGCCGCATCAAAGACTACCTGCAGAG
CCGCATTGTGTACTATCTGATGAACCTGCACATCCGCCCACGATCTGTTTGGATATCGAGAGTGCGTTCCTTTGCCCCCT
ACTCGGAAGTATCTGTCTCTAACGCGCTCAGCATGGCGAGTCGTTGTATAACCTTGACGGTAAAATCGGTGGCGACGCCC
TTCTGTCACCCCGTGGCGAGAAATACGCTCTCAAGCTGCCGGAGCTTGTGCGGCAGTCAGTCGGTGTAAGCAACCCTCTA
TTGCTGACTCGTCCGATTTCTCCCGCTCATATCCTGCCAGGGTGACCGTCCACTCACAGTGTGGACTTCCACGCTCAAGC
GCACCATCGCGACGGCCCGCCACTTGCCCAAGGACTACAACCAGATGCAGTGGAAAGCCCTCGATGAGTTGGACTCGGGT
GTCTGCGACGGCTACACCTACCAGCAGATCAAGGACGAGTTTCCCGATGACTTCCGCGCGCGTGATGAGGACAAGTACAA
CTACCGGTACCGTGGCGGCGAGTCATACCGCGATGTTGTCATCCGGCTTGAGCCCATCATCATGGAGCTGGAGCGGTCTG
AGGACATCCTGATTATCACCCACCAAGCCGTGCTGCGGTGCATCTATGCCTACTTTATGAAAAAGGACCAGAAAGAGAGT
CCGTGGATGAACGTGCCGCTGCACACGCTGATCAAACTGACCCCCCGGGCCTATGGGACCGAGGAGGTGCGGTACGCAGC
GGGAATCGATGCCGTGAGCACCTGGCGAGGAAAAGGCTCGACAGCAAAGCACGAGCAGCTTGCACCAGAGGCATTTCATT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62