GenePrediction:GLEAN_7715 Details

Name: GLEAN_7715
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:361827..361364 (- strand)
Length: 464
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:361827..361798 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_140:361737..361666 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_140:361596..361522 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_140:361447..361364 (- strand)
Length: 84
>GLEAN_7715 class=GenePrediction position=GCSC_140:361827..361364 (- strand)
ATGGCGCCCGCACAACCAGAATTGAAGAAGGTAGGCTCGTTTCCGTGTGTGCCAATATTGCGGTTCCCGCAACTAACGCC
CCGTTTCTAGTACCTCGACAAGCGGCTGTTCGTTCAGCTGAACGGCAGCCGGAAGGTTATCGGCGTCCTCCGTGGCTACG
ATGTAAGCTCCTCACCAGTGATCGCGGCCTTGCGTCCTGCAATACACTTCTGACTTTTTGGCTTGAACTAGGTCTTCCTA
AACATTGTTTTAGACGAAGCGGTCGAGGAAAAGGATGGCGGCGAGAAGGTGAAAATTGGCATGGTGGTATGTAACAACTC
CCGAGTTTGCATGGCTTTTTGTGGCACAGGAGAACTGACAAATGGTTACAATATGTGCAGGTCATTCGCGGAAACTCGAT
CGTCATGCTCGAGGCGCTTGAGAGGATCGGTGGCGATGATAGGAGACAACAACAACATCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62