GenePrediction:GLEAN_7716 Details

Name: GLEAN_7716
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:359352..357846 (- strand)
Length: 1507
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:359352..358986 (- strand)
Length: 367
Type: CDS
Source: GLEAN
Position: GCSC_140:358924..358806 (- strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_140:358697..357846 (- strand)
Length: 852
>GLEAN_7716 class=GenePrediction position=GCSC_140:359352..357846 (- strand)
ATGCCTTTCCTAATTACGGAAGAACAAAAGGTGGATTACCGCCGGCAGGTCGAAGAGTTCCTGAACTCAGCGTCGACCAC
ACCTCTGGCATTCCGAACCGGCCATGATTTTCACCACAACATCGACATTGTTGACCCAAGCGACAACTATGCTAGAGACG
TCGAGAGACGCATTGGTCTTGCTCGCAGAGTCCGACAAAAGATTCGCACCTCCCTCGGCGGTCTGGAGTCTTACAATTTA
AACATCATGCAGCTCTCCTACTTTTTGGCCACCGAAGATACACACGCTTTGCAAAGGATGGTTGAGGACTCTGATGCTCT
AGGATGGTACAATCTCCTCAAGCATGTCGAGCCGTTCCTCAGTACTTGTAAGAGCACATTGTCGGCCCTCCAACCCATCT
CCCTCCCCGTCTAATATGAGTCGTCCAGGTTGCGGAAAACATCAATACCTGGACCGTACCCCCGTGCAGGGAGACGGTTC
GCCATCTGGGACTGCCCCCTGCACATCCCAGGACGAGAGAAGACGACAGGCCGGCGAGGCCGCAATCGTAAGTAGCCCAT
CTCAGGATCTTATCAAGCCTTGGGCCTGACATTATCTGCAGGCTCTGGCGAGAGATCGGAGCGCATGTGTTATCACAAAC
TGCTCTGAGCCACAGGTGGCTCACATCATCCCACATACGATCAACAAGAACGAGACCCACTTTAAGAATGCACGAACCGC
CCTGTTCCAATTCCTTTATACAGCGGCGCCCGCACTGTACGCAGAGGTTCGCGACCTGCTAATTCAGCATGATCCAGTCA
CGGGCAATCCCGTTCTGTCGTGCTCGGACAAGCCATTCAACATGGTATCTCTCAACCACCAATTGCACTGGTATTGGGAT
CGCGCATATTTTGGCTTGAAGCCGGTTTCCGAAACGTTCCCACGTTTCGAGGGAGAAATCGAACTCATTAAAGTCGAATG
GCGATGGCTTCCAAAGCATTTGTCACAAGCCCTAGTTGACAGCGACCACATCCTGCCAAAGAGCAAGGCCCCGAGCCAGA
GGCCGTTTCGTTCAGTTAACCTTGACTCCAAGGGTCTTTCTGATTTCATCGGAAAGGCCCTTGGCGAGATCAGCGGCAAC
GTGGAGGAAATCTCTCCTCCGAGTATCCCTCATGGAAATGGCAGTGGGATTCCTCTGGGGCATCTTCCCTCGGGCCGCCG
GATCGAGTCTGGCTTTCGTTTTGACCTCCGGGCTGCAAAGGATGACGCGCCAAAGATGAGGGCTCTCCTCAAACTACAGT
GGCTCGCTGTGCGCATGGCTTGCATCTCCGGCGCTGCTGACTTTGCAGCCGACCTCCGAGACACGCCCCCGGACGACGAC
AAGCAGATCCAGTCCTTGCTGGAGGCCCAGAGCCAGAAAGAGTGTTCCAGCCTTCTGCAGTCTATTCGTGACCCGGAATA
CTACCACCAAGACGTCGAGGACAGCGACCCCGAGCCGCCTAGAGATGACGAAAAGAAGGGGCCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62