GenePrediction:GLEAN_7717 Details

Name: GLEAN_7717
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:348467..346817 (- strand)
Length: 1651
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:348467..347621 (- strand)
Length: 847
Type: CDS
Source: GLEAN
Position: GCSC_140:347559..346817 (- strand)
Length: 743
>GLEAN_7717 class=GenePrediction position=GCSC_140:348467..346817 (- strand)
ATGACCATTCGGCAGCCATCTATCGCTGCTGAGCGACCGGCATTACTGTTCAACACGTTTACTGACAATGTTCCGGCCCC
GCATTTGACGGAAGCAGCAGTAGTCGCTGTCGATGATAACGGCCGGCTTCCTCTCCAATTCGTTGACCTGCCTAGAGCCG
GAAGAAACACACAGCAACACTGGTACCTCGGCAGGGCAACTAAGGGTGACATCGTTCTGACTTACAATGTGCAGCCACGC
GAAGTCGACATAAAAACACCGGTGGGCTCTCGGATCGACCTTCGTCGTGACCAGGGTGGCCTGCAAGGCGTTGGCTATTG
GTTCTTGCCCCGTGTCCTTTCTGATGCTACATACACAAACATTGTGCAGTGGTTGCTGCCAAGTGATGCACCAGCGGGCA
CAAGGTGTGTTTGGAGTTTTGGGGAAGGACCTAAGCCCATCTATCTCGTTGGACGTACAGACATCACGTGGAACTCGGTT
TACATGGTAGGCCCCATCTGCAGTTACCCGAGTCTGGGCGAATCGTCCACGGCAGAGTGCGTCTGCTACTGGTTTGGCTC
TATTCCAGACGATCTCGACAAGGTGAAAGACTACAACACGGAGCTCTTTCCCAAGATGACGGACTTTTTCCAGCGGGAGA
ATGAGGAATATCGCATATTCATCCGCAAGGCTCTCGTCGGATTCGGTGGGTCGGGATTTCTGGGAAGTTATGTCCTAGAA
TATGACACTTCCATAGAGGAGGAAAGTGACGCAGATCTGAAGCGGTTATTTACACATGAGATGGTGCACAGCTTCTCGAC
ATTGGAAAGCGAAGACGACGGGTCTAGCAACGAATGGTTCGAAGAGGGTTCGCTCATCTCTACTTACCGCTCCCTTCTCG
TTTCTGGCACTGACAACATGCGTTTAAGGTATTGCCGAGTATTACTCCGTCGTACTTCCTTACCGCTTTGGCATGTGTGG
GAAGCTGGACTTTATCTCGGACGTCAACAATCTGGTGCAGGCCTACTTCACCAGCCCGAGGATCAATATGCATATTGACG
ATGCGGCCGCGGGGTTTTTTGCGGACTGGTATGCTGTCTGGATTCCCTACAAGCGCGGTTGCGCTTATTTTATTCTTATC
GACAGTCTTTTGCGCCAGGAAACACAGAACCTGGATATTACGAAACGCAGTGTGTTCGATGACATCATTATCGATCTGGC
CAGGCGAAAGAAAAAGGGGGAAAAAGTCCAAAGCAAGGACTGGCTGGCCCAAGTCCAGCGGTATCTTGGGGCCTCGTCAA
ACTTTTCGGTCAACGAGCACTATCAGGGAATGCGGAGAGGAGAAACTTTGGACTTTTCGGCTGTCTACTTCGGAGACGCA
CAGGCTCGTTTTGTGCGCAGCTCTATGCCAGTTTTGAGCTTTGGCTTCGATCGCAAAAGTCTGCGCACACGTCTTGTGAC
AGGCGTTGTGACGGGCTCAGCTGCTGAGCGGGCTGGCCTTCACGACGGTGATGAAATCGTCAGCGCCTCCAGTCACAATC
GCTGTGCCGAGTTTGGCCAGCAACTGTATAAGCTCATTGTCAAAAGAGGTACCCAAAAGCCTCTGATCACGGTGGAGTTT
CTGCCGAGAACAGAGAAGAAAGTGCTAAATTGGGAGTTATCGTGGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62