GenePrediction:GLEAN_7724 Details

Name: GLEAN_7724
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:296390..295222 (- strand)
Length: 1169
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:296390..296322 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_140:296237..295984 (- strand)
Length: 254
Type: CDS
Source: GLEAN
Position: GCSC_140:295912..295222 (- strand)
Length: 691
>GLEAN_7724 class=GenePrediction position=GCSC_140:296390..295222 (- strand)
ATGGATCACCGATTCCGGTCAATGTTTGCCAACAGTGGCCTGGGCGGCCTTGGAGCGCAGCCGAGCACGGTATGCTTGAA
TCAATGCCCTCTCATGTCCGCTACTTTGGCGTCATTCTTTGCATCTTGTGCGGTGGGAGCTGACTGGGCGTAGGATAACA
CAAACCTGATCGACAACTCCGAAACCGTCTACATCTCGTCGCTCGCCCTGCTCAAGATGCTACGGCATGGCCGTGCCGGT
GTGCCAATGGAGGTCATGGGTCTGATGCTGGGCGACTTTGTCGATGACTTCACGGTCCGGGTCGTGGACGTTTTTGCCAT
GCCACAGAGCGGTACGGGCGTTAGTGTTGAAGCCGTAGACCCTGTGTTCCAGACAAAGATGATGGAAATGCTGCGCCAAA
CGGGAAGGTATGGCTTCCCTCTCCCCTCACCCCCGATTCTTTCTATCGGGCCTGGCCACCCTTGCTGACGACTGCCAGAC
CTGAGTCGGTTGTCGGCTGGTACCATTCGCATCCCGGCTTCGGCTGCTGGTTGTCGTCTGTGGATATTAACACCCAGCAG
TCGTTTGAGCAGCTGACACCACGATCCGTCGCCGTCGTTATTGACCCGATCCAGTCGGTCAAGGGAAAGGTCGTTATTGA
CGCCTTCCGCTCGATCAGCCCGCAGACTCTTATCATGGGCCAGGAACCCCGACAGAGCACGAGCAACCTCGGCCACCTCA
ACAAGCCGTCGATCCAGGCGCTCATCCACGGCCTGAACCGCCACTACTATTCCATTGCCATCAACTACCGCAAGACGGCC
CTCGAAGAGAACATGCTGATGAATCTGCACAAGCAGGTGTGGACTGAAGCCCTGCAGATGGAGGACTTCCGCACAGAGGG
TACCCGGAACAAGGACCGGCTCAAGAAACTCGTCGGCCTGGCCGAGGGCTACGAGAAGCGTGTCAAGGAGGAGACAGAGC
TCACCAAAGAGCAGCTCAAGACTCGCTACGTGGGCAAACTGGACCCCAAGAAGCATTTGGAGGACGTGGGCCAGCAGCTG
ATCGAGGACAACATCGTGGCCGTGTCGCGGCAGATGATCGACAAGGAAACGACAGCGCCGAGAAAGGATGCGGCAACAGC
TGGAGACGATGCGAGCGAACAAGACAAGATGGAAGTTGAGGAATTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62