GenePrediction:GLEAN_7726 Details

Name: GLEAN_7726
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:285062..282737 (- strand)
Length: 2326
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:285062..285023 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_140:284953..284598 (- strand)
Length: 356
Type: CDS
Source: GLEAN
Position: GCSC_140:284337..284284 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_140:284126..283882 (- strand)
Length: 245
Type: CDS
Source: GLEAN
Position: GCSC_140:283802..282737 (- strand)
Length: 1066
>GLEAN_7726 class=GenePrediction position=GCSC_140:285062..282737 (- strand)
ATGTCGACAATACAGCAGCTGAAAAACTTTATTCGCCATGGTTCGTGACCCAGCAAATCACCGCTGCGCCGCCAAATAAA
ACATATGCATTTTGCTAACTTGACCCCAGGGAAGCAAGCTCGCGCCGTCAATGACGGGCAGCCCACCCCGAAAGAAACTT
CGCCGTCTCGTCACAATCATACCCAAAGACACAATCCCACAGCGTCGGACATGGACTCGTCTCCAAAAGAGCCACAGGTT
AAGAACAAAAAGGTAGCCGACGAAGGGATAGCCCAGCTCGTGGCCGACGAGAAAGAGAGTCTTGGAAAAATTCCCAAGTA
TCCTGGACTCGAGAGATGGCTCCTCCTCGAGAAGATGGGAGACGGCGCTTTCAGCAATGTATACCGTGCTCGAGACCGCA
CGGGGGTGTTGTCTGAAGACGTTGCCATCAAAGTAGTTCGCAAATACGAGATGAACGTCTCCCAGGTATGCTTCCTTATT
TTTGTTCTCTCCATTCCTGGTGTGCCTCTGCTTTTCTTCCCCCCCCCCCCACCATTGGCCCTCTGCCTTACGTACACTTT
ACGCATGTCTCGTACACTTTCCGCATGTCTGTACCAGTGTGCAGTCAAGCCCCAAACCAACCACACTATTGTTTCTGTTT
TAAGATGGAATTGTGTTGCTGCGCTTCGTGCTCTTGCAATATGTTTCTCCGTCTTTTTACCGACGCCATGGGCTTGTGAA
CATAGGGAAACGACCGCCTTCATCCGAATTTCAAGCCCAAGCTGCCCAAGGCTGCAGAGGTGGGAACGCCCTTTTCTTTG
TCTTTTTTTCTACGTCATCTTACTTCCTCCCTCGACTTCACTCTTGCCCGCCACTGTATCTTGACAAAACTGCAACGATA
CTTGAAGCAGAAGCTTTGGCCCCGCATGCAATGCATTGGTTGCTGACCACTAGCAGCGATCGAACATTCTTAAGGAAGTG
GCGATTATGCGGAAGCTCGACCACCCCAACATCATCCGTCTGATCGAGTTCTCGGAGGCGAAGCAGTACTACTACATCAT
CTTGGAGCTAGCACCTGGAGGCGAGCTTTTCCACCAGATCGTGAAGCTCACTTATTTTAGCGAGGAGTTGTCTCGGCACG
TCATCGTCCAGGTGGCTAAAGCTCTCGAATACCTTCACGAAGAACAAGGGGTAGTGCACCGGTATGTTCTTACCTAGAAC
AGGCTGTGGATTGCTACTACCCTGGATACCTTGCTGGATACCTTACTAAGTGCTGAATAGTGACATCAAACCCGAAAACA
TCTTGTTCTATCCCATTCCGTTTGTCCCTGCAAAGAGTCCAAAGCCTAGGCAGGCTGGCGATGAAGACAAAGCCGACGAA
GGCGAATTTATCCCTGGCCAAGGTGCCGGCAGGATCGGCAAAATCAAGATCGCCGACTTCGGTCTGTCTAAAGTCGTCTG
GGAAACGAAGACCACAACCCCATGTGGAACTGTAGGCTACACGGCTCCCGAGATTGTCAAGGATGAGCGGTACTCCAAGT
CTGTTGACATGTGGGCACTTGGATGCGTTCTTTATACGCTTCTCTGTGGGTTCCCACCGTTTTACGACGAGAGCATTGAG
GCCTTGACCGAGAAAGTCGCTAAGGGCGAGTTCACCTTCTTGTCGCCTTGGTGGGACGATATTTCCGAGTCCGCAAAGGA
GCTTATTTCCCACTTGCTGGACGTCGACCCTGAAAAACGATACACAATCGCCGAATTCCTGAACCACCCATGGGTACGCG
AGCCCGGTAGTACTCCTAGAAAGGTGGCTTCAGAAGGAATATTCCATCCGCTTGATCGGATCATCGATGGTGACAGACGT
TCGGACTTCCGATCCCCTGGCGCCGTCAATCTCCGAGAAGTATTTGATGTTGGCTATGCCGTGCATCGTCAGGAAGAGGA
AGACAAACGACGCAAGCACGTTGGCACCCGTGCTGCAGGTGTATCACGCCTTGCAGAGCTGAACGAAGAGCTGAGCGAGG
AGGAGGATCAGTCTGAGCTGCCCGAAGCGAGGGGCAACGATGGCGACGCCGCTCACACCGCACCAGGGATTGCCGCATCT
AACGGAGCACAGGACCTGGAGCAGAGCATGCGGAACACGAACATCCGGGACCAGGAACAGACCCGTGGCCGAGAACGCGA
AAGACGATCGGACCGGGGCTACGGTCAGCATTCGGCTACGGTGGCTGCTGCAGCGCGGCAGCAAGTCCGAGACCATAACC
GACAAAAGGGTGCATTCGAGCTGAATCTCGATGGGGCTACATTGCTCGGTCGGCGTGGCGCCAAACCTGCGGCTAGAGTG
GCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62