GenePrediction:GLEAN_7729 Details

Name: GLEAN_7729
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:266833..261977 (- strand)
Length: 4857
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:266833..261977 (- strand)
Length: 4857
>GLEAN_7729 class=GenePrediction position=GCSC_140:266833..261977 (- strand)
ATGACGACTGCGGCTACCAGCACCACGGGTAGCGGCCCTGTAAGCGTTGCCTTTGCGTCAAGCATCGACCGCGACAGCGA
GGACTACCGAGAGCTCAGCAAGGTGTGGAAAGATGTTGAGAGCCGCGTGCAGCGCCTGGCCGAGACGAGAACTCTCTCGC
TGGCCGGCCAGGTACCGAGCTTGCAGCGTAACCTCGACATTGACGGCGTGCTCAAGATCATGAAGAAGTCCAAGGAGTAC
AGCGAAAAGGAGACAGTCAAGTACGCGCGCGTGGAGAAAGCCATCAGTACGACGCTGCGCTGCATCAGCAACATCGGCGG
CATTATTGCTGATGGAGTGTCGACCGTGTTCGAGCCGGCACAGACATGCTACAACGCGCTCACCTTTGTCATCCAGGCGT
GGCAGGGCTATGTCGGCATCTTTGAGAACCTGGCAGACCTTTTGGAGCGCTGTGTCGAGTTTCTTGAGCGGCTGGATCAC
TACAAAGCCTACATGGACGTTAAGCTGACGCGCGTGGCCGTGCAGTATCTGAATCTGTTTGTGGACATCTGCGACCGCAG
CATACGTCTGCGCAAGAAGCACGTCAAGCTTCTGGCCTTTACCAAGATGCTTTTCCTCAACGACGACGAAGTCCGCTCGC
ATCTGACCGATATGGGCAAGCTTTTCGACAAGGAGCGCGGCTTGGTGCTCGCGCAGGTCTTCAACTCCACCAACGACAAC
AGCGCCAGCCTGAAGGGACTGGCCAAGGACAATAACGACCAGAAGAAGGAGAGCGAAGGCAGGCGATGGCGAAAAACGAT
TGCCAAGACTCTGGGATTTGAACCTGGTGATCTGGACCCTGACTCGGAGCCGGTGGCCAAGTGGCGCACCATGCTCAACA
AGTACAAGAACCTGCTGTCGCTGCTGGAAGACACCGGCCAGTGGATCATGGACGACGCCGATGGCCCCTTTATGCAGTGG
GCCACCGGTGCCAGCAACCGGGAAGTGCCACCGATACTATTACTGAACGGAGAGCGCGGGTCTGGCAAGACATTCATGAT
GGCCAACGTGATCAAGTACCTCGGCAAGATGGATGGCATTGCGTCCAAGGCAGTGTTGTCGTACTTTTTCGTGCAGCCTG
ACCCGAAGCAGGCGGGTTTGCGGGATGGCGTCAGCATCCTTGAGGCAGTGTCGCGCAGTCTTTTGTGGCAATGTGCAGTC
GGCTCTGAAACGATGACGCGGTCCATTGGACAGATGTGTGAGAAGGGTCGGGATCTGGTCGGCGCTGTCGACATGTGGAG
CAAGCTGTTCCTGAACAACGCCGAGCGCCAGAAGACAGATACTGTTTTCTATCTCTTTGTCGACGGGCTGGATGACATGT
CGCTTGTGCTGCCACTGTTGCGGCGTATCAGCGCAGACAAGGCCGAACGCCGAGTTCGCGTGTTCCTGACAACGACACCA
AAACTACAGAACCAGTTGGGCTCCCTCGACTTCCGATGCATTGAAATTCACGGCAGAAAAAAAAAGGGCATTGCGCACGG
AAAGAAAGACAAGCACCCTGTTCACAGCAACGACAAGGACATTGCCAGCTACATCTGCTACCGGATGAACCAGATGGACA
TCCTCAAGGACTCAACACGCCCCGGCATTGATGAGTGGCGAAGAAAAATCCGAGAGGAGCTCCAGGTAAAGTGTGACGGC
GACTACTGCAAGCTCGTCACGAGTCTGGACGCCATCGCCAATGCCGACTTCGTGGACGACATCCAGGCGGTGCTCGATAA
TGCCCACGGTACGCGTGCGAACCAGATTGTTGCCGAAATCGAGCGGCTCAACCGCGCGCGGACGCTCAAAGAACGCATAG
AGATCAACGAGATCATCTTGTGGATTCAAGGTGGCGAATCGTGGCTCTCGGTCGAGGCCATGGAGGCCGTCCTGGCTGTG
AAGCACAATAACGGGCCAGCGATGACATCGCTTTTGCTCTTTGACGTCAAGATCAAAAACAAGTATCCCATCTTTCAGAT
TGACTCCAGCGGCAACGTGAATTTCCGCTCCGATGAGGTCGAGACAGCGATCTCCGCCCGCACGGTGTCTGCATCGTCAA
CCTCCCCAAAGCGCATCACGAACGGCGAGATTTCCCTTGTTCAGCACTTACTCATCACCTTCTGCCCGCCGGACCTGTAT
GGACGCTTTCAGTTTGATCATTTCTTTGCACACAAGGCCGATCCACCGCTTCACAGCACGGATATCTGCAGCGACCCAGA
CAATATGCATATCCGCATCGCCCTCTCCAGCCTCATGGTATTGACGAGCCCAAAGGACAAGCCCACGGCTGCCATTCGCC
ACTATGCACGGGTAAACTTGCTTAAGCACCTCTGCAAGACCGACCTCGACAGGGCAGACAAGGGGCTCAAAGCGGCCACG
GGACAGCTGTTGGTCGCTTTATTCACGCGAGATGTCGGCATCGATGCGCTGTTCTGGATCGAGTGTGACACGGTCTCGCA
GCAGAGATGGGAGATGGAAGAGAACAGGTTCCTCCGCCTCGTGCGCGTCGACTGGTTGTACAGCTTCGACGGTGTGGACA
TCCTGCTAAAGTGGTTTTGTGACGCCGACGTGGTGCATGAAATCGCTACCAACACAAGGGAAGGCGCCTTCGTGGCCGCT
TTCACAAAGCAGGGCGCCAACCGGCACGAGGTGCTGTTCAAGCCGGCAGCAAAGCGACTGGCTCAGAAACTGCTGTGTTT
TGATCACTGCTCGCTTCGTGAGGCTCATACCTGGCTGTTTTTCTTGAACGGATTCATGGACAAGCTGCCACGACAAGAAA
TGAAGCCTGTGACGTTGGGGTCGGTGCAGACACCAGCTCAGCTCGAGACTGGCGGTAGTGACAGAGGAGATGTTGGCACA
GAAAACGACGGCACTGTCCGTCCACTCAATGGCAATGATCAACATGACGGCAACGACGACCTGCCAGAGATTCCGCGCTC
TGCCGACGCCATTAACGAACTCGATGGTGTGGCTTTTAGGAAAATTGAGAAGCGAAAGGTTAGCCTGGCGCAGTTGACGC
GCATCGAGAATTGGGCTTCCATAGCGCTCGAGAAGAGTGGTGCTTGCGAACCACTGTGGGAAGTGCAGATGGCCGCCATC
ATATCCTACAGCTGCAACCACCTCAAGGCCGAGACGATAGCCGACCGGCGTGCACACAAAGCACTGAAGAAAGACCCCAG
TCATTGGCTTGTGTGCTATTACCTCTCTTGTAGCGAGGCAAAAGACGAAGCCAGTATCAATCTGTTGCTACGTTCCCTTC
AGAGCATCGAAAAAATACAAAATAGCAGCGACAAGACGCGCTGGAACGCAGCAAGAGACCACCAGCTCATTCTGGCTCAT
ATCCACCTCCGCTTGGGCCATAGGTACTGGAAAACCGGGCAGTTCGAAAAGGCAGTTCAGCACCACCAGGAAAGCTTCAA
ATTCAGCGGGACGCGTTTCCGGGAGTACATTGAGGCACTGTTGCTGTATAGCGGCGAGAAGCATTGGGACGAAGTTATTG
CGCTTTTGGGCTGGATACTGGATTGTGTTGAGCAGTGGCCGCCATACTTTAATGAGCTGTACACCATATTGATCTCCAAC
CCGAAGTTTGACGCCGTGGTTCCTGCAGCGGCCAACGCACTGGACCGCTGGGACACAGTGGAGAATCTGTTTGCACAGGC
GACACGCATTGCTCGCAAAAGGGAAGACTGGGATAGCACGTTTGGCATGCTCAAGTCGCTCGGCGATATGCTATACAAGC
ATGACGCCGATCTGGAAAGGCACGAGACGGGCGTGGTGGCGAGCTGGGCCGCAGCCATCGAGGTGTTGGTGGCTCACCCG
AGCGACGGGATCGCGATGGGCAGCGTGACTGAAATTGCAAACAACCTATCACGCATCTACCTCGAGCAAGCGCTGCGTCA
TCTGCGCGAAGCTGGTGGGAGAGTCCCAGAGGACAAGGCCAAAGAAGTGGAAGCGACGCAGTTGCTGGACAAGATCACGG
CACTCGTCTTCCCCGATGTGGCACCTATGTGGAACCGTACTGTGTTGTGCTGTGTTGCACGCTACCATGTCCAGGTGGGC
AACATGGTTGAGGCCAAAAAGGCAGTGGCTGACCTGATGGAGGCCATCATGGCCATGCTGAGTGATGATGATCCATCCAA
CGATGAGTGGGCCATGATGTGTCTGGCAGGAGTGGTCAATGTCTTTGCCGATGAGGAAAACACAATCGCTGCTTGGCAGG
TTGTAAACCTGATCCAGACCGAGGCGATAACAGCACGTAGGGCGTGGGAAGAGATGATTCCAGATGGGGAAATGTCTGAG
AGTCGCGGCAGTATTGCCGAGGTGGAAGTTGACGATGGGGAAGGTGCAGAGTCCGCTGCCGGGGAGAATGCGAGTTTTAC
GACGCTTGACACGACAGACGAGGACGCACACACAAGCGTTTCCGGATCGGTAGAGAGCGACCACGTTACCACTGACGGAG
AAACCGTTGCGACCGAAGATGTCGATGATGCCTCCTCCGTCAGCTTCGGTTCTATTCCAGATGCACCCGTGGCACTGCTC
ATATGTGGCGGCTGCAATGAAGAGTTTCTGTACGCCAGTCAGGCATACATGTGCTGTGACTGCGTCGGCACGGTCTCGTT
TGACGAAAAGTGCTATCAGCGGCTCCAGAAGGGCGAGCTGTGCAGGTCCACCCCGTCCGTGTGCAATAAAGCCCACCACT
TCGTGTATCTGCCAAAGTGGGATGATGAAGCAGCCAAGACCGTGCCCAAGGGGTCACTGCCGATGGGAAGCGACACGATC
AGGCTGGAGGACTGGAAAAAGGGGCTCAGGGCGAAGTATATGGACTTGGGGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62