GenePrediction:GLEAN_7732 Details

Name: GLEAN_7732
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:249641..246033 (- strand)
Length: 3609
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:249641..249501 (- strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_140:249401..248207 (- strand)
Length: 1195
Type: CDS
Source: GLEAN
Position: GCSC_140:247096..246033 (- strand)
Length: 1064
>GLEAN_7732 class=GenePrediction position=GCSC_140:249641..246033 (- strand)
ATGATTGCGTATCTTGCGGCGAACAACTACACAGCCAGCGCGGCGGCCCTGCGAGAGGAGCTCAATCTGGACGAGTCCCA
GTATGACGCCACGACGGCCAAGAAGTACGAGACGCTGCTGGAGAAGAAATGGACGAGCGTTGTACGGTTACAGCGAAAGG
TGGGCAGCCGGGAGGAGTTCTGGCGTCATGGAGAGGGGGGGTCTGTTCCGCTCTTTTTCTTCACAGTCTAACACGGGCAG
ATCATGGACCTGGAGTCCCGGAACAACGCGCTGCAGTCAGAGGTGGACAACGCGACTCCCGGATCGCTGATGCTGCGCAA
CAAGGATCCGGCATCGTGGCTGCCCAAGGCACCACCGCGATACACGCTAGAGTCGCACCGCAACGCGATCAACTGCATTG
CGTTCCACCCGACCTTTTCGTCGCTGGCCACGGGGTCGGACGACTTCACGATCAAGATCTGGGACTGGGACATTGGCGAG
CTCGAGAAGACGATCAAGGGCCACACGCGGGCGGTGCTGGACGTGGACTACGGCGGGCCCAAGGGCAACGTGCTGCTGGT
GTCGTGCAGCTCGGACCTGGCGATCAAGCTGTGGGACCCGGCAGACGACTACAAGAACATCCGGACGCTCTCGGGCCACG
ACCACAGCGTCAGCGCAGTGCGCTTCATCCCCAACTCGGCCAACCTGCTCGTGAGCGCCAGCCGCGACATGACGCTCAAG
ATCTGGGACGTTACGACCGGCTTCGTCGTGCGCACGCTGCACGGTCACACGGCCTGGGTGCGCGATGTTGTGCCGGCCTT
TGACGGCCGCTACCTCGTCTCGTGCGGCGACGACATGACGGCGCGGCTCTGGGACATTACGTCGGTCGCCACGACGAACG
AGAGCAAGCTGACGCTCTACGGCCACGAGCACTACATTGAGTGCTGCGCCCTGGCGCCGCCGTCGGCCTACGTGCACCTC
GCGCAGATGGCCGGCCTCAAGCGGCCGCCTTCAGCAGCCAGCTCGGCCGAGTTCGTCGCCACCGGCTCCCGCGACAAGAT
GATCCGGCTCTGGGACGCCCGAGGCACCTGTCTGCGCACGCTCATCGGCCACGACAACTGGATCCGCTCGCTCGTCTTCC
ACCCCGGCGGCAAGTTTCTGCTCTCGGCCGCCGACGACAAGACGGTCCGCTGCTGGGACCTGGCCCAGGAGGGCCGCTGC
GTGAAGGTGATCAGCGACCCGCACGAGCGCTTTGTCACATCGCTGCGCTGGGCCCCCAGCCTCGTCCGTAGTGCCGGCGG
GACGGATCAGTTGGCGGCAGGGCTGAGCGGCACGGGCGCCGACCAGAACGGCAACGGCAGGACCGACACCACCACGGTCG
CGGCCAACGGCACGCGAACAAAGGAGCCACAGGACGTGCAGATCCGCTGCGTGGTAGCCACGGGATGTGTGGACTGTAAG
CTACGGATCTTTACGAACTAATGAGCACCCAGACGTCCAGACGAAGTGAAGAAACTACAAAACAGACCAGACAAGAAGCT
AAAGCGAAAAGCACAAAGCACAAAGCACAAAGCAAACAGCACGCATTATATCCCCCATCCCCCGTTTGCAGATGCACGTG
GTAGGAGCCATGCGTGAGCAGCCCGCCCGCTGCTAAGAATCAAGGGGCCGGCGTGCCGGAACAGCCGTCTGTGGTTGTGT
CATCGGACATGGGCAGCCGAAACACGACAAGGTACGCGGTCCCTCCACACAGAAAGGTGCAGGAGACGACAGCAGCGTCC
TCATTGGCAAGGACGGGTCGGGGAGAGCATGAGGAGGAGTATTTTTGAAAGATTAGAGAATGGAAGCATGTAGATATCAG
CGTGTGGAACTTGTTTATGCTGCTCTCTCTCCGTTTCGTCTGTACAGTTGGGAAATAGAAACGAACAGGGTTGTCAGCTT
TACGCTTCTGTGCTGGTGGTGGGATGATGTGATTGGTCAATCCAATTGGCCAATGCAGCTCCGATCAAACTTGCGTGGTC
GGACAAACAGCATTGGGCCAACGCAACCTGAGATACGAGTTCGAAGTTCTCGGGCTACTGGCAGCACCAGCTTACAGAGT
ACGGAAAAGAGGCCCTGCCTTTCGAAGACAACTGTCCTGCATCGAGACGTCCACAGCACCAGAGCCAGCATGATCACCAG
GTCCTCGGCATGGGACTGCAGTCCACAGTGGCAATGCATGACTGGTCTTGCGTAATCTCGTGACATTCAACATGGTGGGG
TTCATTCCGAGGCTAAAGTCACTAGCGAGAGGTAATCGCCGCGACTGGGGACATGTCTCGGCTGGACCTTTCCGACGACC
GGCCACGTATTAGTCGAAAACGTCGATGCAGAAGACAGAGCTGCTGTCAGAAACATCACAAAAGCAGCAACAAGCAGCAA
CAGCGAAACGGAAGCAAGCAAGAAACGAGCAGAACGCGAAAATGGCCATTGGAATTGCAATGTTGGGAGCTGGCATCTTT
GCCACGCGAGGTGCGTGGCTATCTGCCGTCTTGTCCACCTTGTCTGCCTGTCTTCTCTCTGATAGCAACAGAGCACCTGC
CGGCCATTGAGGCAGCGAGCGAGCTAGAGCTCAAGGCGATCTACTCGCGGTCGCAGAAGACGGCCGAGACGCTGCACGCC
AAGGCCGGCAGCAGCAGCGCCGTGGACGTGTATTTCGACGAGCCGGCGACGGCAGGCCGCGGGCTGGCAGATCTGCTGGC
GCGCAGCGACGTGGCAGCAGTGGCTGTGGGCATACCGATCACTCTGCAGCCGGCAGTCGTGCGCCAGGCGCTGGCGGCGG
GCAAGCACGTGATCAGCGAGAAGCCGGTGGCAGCGACGGTGGCAGAGGCGCGAGAGCTGATTGCGGAGTATGAGCAGATG
TCGTCGTCGTCGTCGTCACGGCCGTTGTGGGCGGTAGCCGAGAACTACCGGTACCAGCCGGGGCTGCAGGTGGCGGTGGC
CGAGGCGAGACGGCTAGGCGGCGAACTGGTGTCGTTTTCGCTGCATAGCGACCGGCTGGTGCGCGACGAGACCAGCGGCG
GCTACATCAACACGTCGTGGCGACGCCAGCCGACACATCCGGGCGGCTTTCTGCTGGACGGTGGCGTGCATTTTGTGGCA
GCGCTGCGACAGCTGATGGGCAGTTTGGGAAGTCTAGGAGATGCCAGCGAGATCGCCCGGCTGGCCTGCTTTGCCGCCCA
GCTGCAGCCGCACCTGCCGCCAGTCGACACTCTGCGGGGCGTCGCTGTGACGCGAGGCGGCGTCAGCGGCGTGCTCAACA
TGTCGTTTGGCACCGAGTTTGGCGGCCCGCTGCTCGAAGTCGTCGTCACTACCACCGAGGGCCGCCTGACCTGGACGCCG
CGCTGCGTCACCGTGATGCGCCGCGGCGACGTCACTCCTGCCGTCATCGACACCGCCGACCCGGCTGCCTTTCCGGCCGC
CGAGGCCAACGGGGTCAAGGCCGAGTTCGCTGCGTTTGCCCGCAGCATTGCGACCGGTGCCGCTGCCGTCGACCAGCTGC
AGTCGCCCCGCGAGGCCCTGCAGGACCTGCTCGTGGTGGAGACAATGCTGCAGTCGGGCGCCGAGGGCGGGGCGCTGCGG
GAGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62