GenePrediction:GLEAN_7734 Details

Name: GLEAN_7734
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:240605..239642 (- strand)
Length: 964
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:240605..240539 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_140:240480..239642 (- strand)
Length: 839
>GLEAN_7734 class=GenePrediction position=GCSC_140:240605..239642 (- strand)
ATGGGAAAGAAGCGGCGCAACTACCCGAACCTGGAGGAGCTGTTGAGCCGGCCATGGTGTTACTACTGTAGGTGCCTTTT
CGTGTGTGTGCCCGCGAGCGCGTACCGGCTGAGCTGACGGACCAGGCGAGCGTGACTTTGAGGATCTGAAGCTGCTGATC
TCGCACCAAAAGGCCAAGCACTACAAGTGTGACCGATGCGGTCGGCGGCTGAACACGGCCGGCGGCCTGTCGGTGCACAT
GAACCAGGTGCACAAGGAGACGTTGGTGCGGGTCGAAAACGCGATCGAAGGCCGCGAGGGTCTAGACGTGGAGATCTTTG
GGATGGAGGGCGTGCCCGAAGCCGCTGCTACCCAGCACAACAACGAGATCTTGCAGGGCTTCCAGAAGGACCGGGCCAGC
CGCCAGGCCGTGACCGGAAACCCACAGCCTGGTCAGCCCGGCGTTCAGCGACCGGCCAAGAAGATCCGCATCGAGTCGGC
CGACGAGCTGAAGCACCGCCTGGCCGAGTACCGTGCTCAGGAAGGCGCTCGCAAAGCTGCCGCAGCTGCTGGTCCGCCTC
CTGCTCCCTCGGCTCCCATCGCTTCCGCTTCTGCTTCTGCTTCCGCTTCCGCTCCTGCTACCTCGCCTACCTCTCTCCCC
AATCGGCCTCCCAACAGCGGCATCGGCGGCCCTGCCGGCCTGCCCCAGCGACCCTCCGCCTACGGCACCGGTGCTGCCTC
CACGCTCGATGACCTCGTCTCTGGCGCTGCTCACGGCGGTGACGACATCGACAAGATCATCCGCATGGCCGAGGCCGGCA
TCCGTCCCCCTGCTCCTCAGCCTGGCCCGCCTGCTGCTCAGCCGGCCGCACCCGAGAAGGAAAAGAAAAAGGAAAAGGCT
ATGCGCATGGTCTATTCCGACGGCGACTTCAGCCTCGAGGAACGCATGGCCCTCATTCCTCGTTATGCCGTTGCAACGGC
CTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62