GenePrediction:GLEAN_7737 Details

Name: GLEAN_7737
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:220391..218847 (- strand)
Length: 1545
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:220391..220364 (- strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_140:220287..220120 (- strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_140:220012..218847 (- strand)
Length: 1166
>GLEAN_7737 class=GenePrediction position=GCSC_140:220391..218847 (- strand)
ATGGAGGAACCGCAAGCCATGGCAAGAGGTGCGTATGCAGACGTCCAATGAGCTCTACCTGTCCTTTTCCTCCGTCCTTC
ATTTGCTGATGGGATCAGACGCAGCCTGGTCGATTCCGACCGAGATTCTGCGGGCAGAGCTGGCTCGACGAGCTTCCGAC
GAAGAAGCCGGCCAGCCAACGCGGCCAGTCTGCGGCTCCGGCAAGAAAGGAGCCTACGAAACCGGCCTTCACGTGTTTGC
GCTCTTCCTGATCTTGACGATCAGCATATTAGGTATGTGCAGCTTCCTGCGAGCAGCTCGGGTTCTTCCGGTGCCCAAAG
CCGTCATTTGCCTCTTTGGAATTAGCTGCAGCAGGCTCACACTCAACTTCGCCTCCCAGCATGCGGCTTCCCCCTCTTCA
ACCGCCGCACCAGCAAAGGGATGCGTCCCAGCAAGATCATCTTTCTCTGCCAGCACTTTGGCACCGGCGTGCTGATCGCC
ACGGCCTTTGTCCATCTCCTCCCGACAGCCTTTCTCTCGCTGACCGACCCCTGTCTTCCCTACTTCTTCAACAAAGGTTA
CAACCCGCTCGCCGGCCTGATCGCCATGGCCTTTGCCCTCAGCGTCGTCTGGCTTGAGTCCTACCTAACGACACGCGGTG
CCGGCCACTCGCACTCGCACATGTGGGAGGAAGTCGACTCGGACGATCCCGACGGCGGCCACAGCCACGGCAACGGCGCT
GCACATGGGCCGGCCAACGGCCTGGCTGCACACCGCAGCTCGAACCATCGTCCGAGACACATTGTGCTGGGCGATCGGAG
CGCGTCCGAGGGCCTCATGGCCGGGGCCTCGCCGCTGCCTGAGTCGACACCGACACGGCCGGGTATAGGGAACAGGGGCA
AGAATAACAATGTCAATGTCAATGATGACATTGACGACGGCGACGGCGACGACGATGATGACAATGACGACGAGCTCGGA
CTCAACGTCCGCCTCGACGAGCTGGATCAGGCTCCAGACCAGCCGCTGCCGGTCGGCGAGACGAGTGCACCCCATCTGCC
CGATTCGGCCGAGCAGAAGCGGCTCATGCTGCAGTGTCTGCTGCTCGAGGCCGGCATTCTCTTCCACAGTGTGTTCATCG
GCATGGCCATTTCGGTCGCGACCGGGCCGGCTTTCGTGGTCTTCCTCGTCGCCATTGCCTTCCACCAGTGCTTCGAGGGC
CTGGCACTCGGCAGCCGCATCGCGGCCATTCACTTCCCTCGCGCATCGTACCGGCCTTGGCTCATGGTGCTGGCCTATGG
CACGACCACGCCTCTCGGCCAGGCCATCGGCCTGCTCGTTCACAACCTCTACGACCCTCTCAGCCAGACCGGCCTGCTCA
TGGTCGGCATCATGAACGCCATCTCCAGCGGCCTTCTGCTCTTTGCTGGTCTCGTCCAGCTCCTGGCCGAAGACTTCCTC
ACCGAGAAGAGCTACAAGACCCTCCACGGACGGCGCAGAACCCAGGCGTTCCTGGCCGTCATCTCCGGCGCCATGTTGAT
GGCCGCCGTCGGCGCTTTTGCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62