GenePrediction:GLEAN_7739 Details

Name: GLEAN_7739
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:215971..214180 (- strand)
Length: 1792
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:215971..215861 (- strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_140:215793..214180 (- strand)
Length: 1614
>GLEAN_7739 class=GenePrediction position=GCSC_140:215971..214180 (- strand)
ATGAGACCGGTTGGAGGCGCGCTGCTGGCGCTTGCTGCGGCACTGTTCTCGCAGCTGCAGCCGGGCGCCGGCCTGCAGAC
GTGGCAGCCGATTCGCCATCTAGAAAAGCAGGTGTGTATGCGTCTCATTCTGGCTGCCTGCCATAGCCGCTACTCTGTAC
AGCTTCTGACTCCAACAGATCCAGTCAGGCCCCAGCCTGTCTGCCCACGGGCACGACATTGCGGACGAGTACCCCGAGTA
CCCGGCACACGTCCTGCGCGTGCCCATTGACCACTTTCACAACGACTCGCTCTATGAGCCACACGTCGACGGCCACTTTG
ACCTGCGCTATTGGTTCGACGACCGTCACTACCGGCCAGGTGGCCCCGTCATCGTGCTGGCAGCCGGCGAGACTAGCGGG
GCTGACCGGCTGCCGTTCCTGCGCAAGGGCATCGCCGCCCAGCTAGCCGCTGCCACGCATGGACTCGCCGTCATCCTCGA
GCATCGCTACTACGGCGCCAGCTTTCCGCTTTCTGACCTCAGCACTGCCAGTCTGCGCTTTCTGCGCACCGAGCAGGCCC
TCGCCGACACCGCCTACTTTGCCCGCCACGTGCGCTTCCCCGGCCTCGCTCACACCACCCCTGGCTCTGATGCCCCCTGG
ATTATCTACGGCGGCTCCTATGCCGGCGCTTTTGCCGCTTTCGCTCGCATCCTCTATCCCGACGTCTTCTGGGGCGCCAT
CTCTTCGTCCGGCGTCACCGTCGCCATCTACGACTACTGGCAGTACTTTGAAGCCCAGCGGCTCTTCAGCCCGCCCGCTT
GCGTCAACACGACCCAGACCCTCATCCATGCCGTCGACCAGATTCTAAGGCCTGCGGGCAAGCAACAAAGACGCCACGCC
AACCAACAGCCGCTGAGAGCGCTTCAAGACGAGCTCGGAGAGCTTACCTCCGATCACGTGACCACGCTCAAGACCCTCTT
CAACCTGGCCAACGTCACCCACGACGACGACTTTGCCGCCCTGCTAAGCGAGGGCCTGGCCGGCTGGCAGGACACCAACT
GGGACCCGGCCGTCAGCAGTCCTAGCTTCGGCTGGTACTGCGGCAACGTCACCGCCGACACGCTGCTGTTCCCCGAGCTG
GAGGCCAGCCGGAGCGTCGCCACGACGTTGCTGGCCGCTACGACCTATAGCCACGAGGCCGCCACGCTTGCCGACGCCCT
GCTCAACTTTGCAGGTTGGGTGCGGGCCACATTCCAGTGCGCTGACGGCCGGACGCAGGACCAGTGCTTCAGCAACCGCA
ACGCCACCTTCTACCGCCAGGACGATCTCTCCCAGCACTGGCGAGCCTGGCCCTACCAGTACTGCACGCAGTGGGGCTAT
CTGGCCACCGGCTCCGGCGTCCCGAACGACCGCTTGCCGCTTATCAGCCGCTTGCTCGACCTCGAGTACCTCTCGATCAT
CTGCCGCGACGCCTTTGGCATCACCGGTCCGCCCGACGTCGAATCTGTCAACCGGCTCGGCGGCTTCGACATCCAGTACC
CTCGACTGGCCATCGTCGACGGCGAGGCCGATCCCTGGCGTGCTGCCACGCCACACGCCCTCGTTGGCGCCAAAGACCGT
CCTAGCACCACCGATGAACCCTTTTGGCTCATTGGCGGTGGCGCCGTTCACCACTGGGACGAGAACGGCCTGCTGCCTGA
CGAAACCTCCGCTGACCTTCCGCCACAGCCCATTCTCGACGTCCAGGCTGAGGAGGTACGGTTCGTCAAAGCTTGGGTGG
ACGAGTGGACCGCCCAGAAGAGCAGCCTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62