GenePrediction:GLEAN_7740 Details

Name: GLEAN_7740
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:210142..209167 (- strand)
Length: 976
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:210142..209721 (- strand)
Length: 422
Type: CDS
Source: GLEAN
Position: GCSC_140:209646..209336 (- strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_140:209285..209167 (- strand)
Length: 119
>GLEAN_7740 class=GenePrediction position=GCSC_140:210142..209167 (- strand)
ATGCATCACTCTGCTCTTCCTGCTCTCGTCGGCGCCCTGTGCCTGCTGCTCGCCGGCGGCACTGGCGCTGTGTCGTCCGT
GTCGACCGACACTATGGCGACGTGGCTCAGCAATGGCGGCGTCGACCTCGCCGAAGCGGCGGCGCCCATGTGGTTCTTCG
GACAGGCCATGGACGAGCCGCCGTGCTATCCGACAGCGGCGCTGGACAGCAGCAACGGCCAGGTAGCGTCAGTGGCGCTC
TGCGACTGGCCCGACACGGGGTGCAACTGTCGGAAACCGGGCGTGGCCATCAGCAATCCAGGGCCGTCGTTTCCGGTGTA
CTTTTCCTTTCTGAAGTGTTCGAGCTCAGAGATCCGCGTGGTCTACAACCTCTTCTATCAAAAGGATGGCTTCAACCCGT
CGGGAGTGTTTGGACATGCCTAGTAAGTTGGGTGAGAGAGGAGAGAGGGCAAAGAAAGAGAAAGAAAGAGAAGAGACAGT
CATAGCTGACCATCAGCGACTGGGAACGCGTCGTCGTCAAGTGGACGCTCTCCGGCAGCTGGACGCCGTCGCACATCATG
CTGTCGCAGCACTCGGGCTACCAGACGCTTGCCTGGGCCAAGATCCAGAACACGTTCAACACGGCCGACGTGTCGCTCTC
GCGCGCCGGCTCCAACGGCCGGACAAACCTCGATCACGCAAAGGTCTATGTCGCCTGGTCCAAACATGCGCACTACAACA
CGCGCAATACCGGCTACAACGACGCGCTCTCACAGCTGACCGACAACGCTTTCCGCAGCCAGGACTGGTGGTACTTTCCC
ACGAGCAGTGCGTCCTTTTCTTTCCTTTTCCCTTATCGCTCCTCAGCTGACCATCAGGCGACTACATCCTCGCCGACAAC
TCCACCAGCGCTGGCAAGATCCTCGGAAGCTTCGACTGGGGCGATGCCACGAGCGATCCTCTCTCCGTCTACGAGGGGCT
GTGCTCGGCATCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62