GenePrediction:GLEAN_7741 Details

Name: GLEAN_7741
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:208170..206180 (- strand)
Length: 1991
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:208170..207871 (- strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_140:207814..207325 (- strand)
Length: 490
Type: CDS
Source: GLEAN
Position: GCSC_140:207268..207034 (- strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_140:206966..206180 (- strand)
Length: 787
>GLEAN_7741 class=GenePrediction position=GCSC_140:208170..206180 (- strand)
ATGTCCGACTCGTCCGGATCATCCAAGTTTGGCGAGCTGCAACTGGGCACCAGCGGTCCGCTGGAATGCGCTCTGCGCGG
CCCAATGATGCTCAAGCACACCGTCTTCAACAAGGGCTCGGCCTTTACGGCAGCGGAACGTCGTGCCTTTGGCCTGACCG
GTCTACTTCCTGCCAGCGTGCAGACGTTGGAGCAGCAGGTCGAGCGAGCCTACCAGCAGTACAGCAGCAGGCCCAATGAC
CTGGCCAAGAATACGTTTCTGTCCTCTCTGCGCGACCAGAGCCAGGTGCTGTTCTATCGGGTACGCAGACAGCAATAGGC
AGCAAGCACGCAGACAACAGCTAACCAGGCCCACAGCTTGCCCAGGACCACATCAAGGAGATGTTCAGCGTGCTCTACAC
GCCCACCGAAGGCGACGCGATCCAAAACTACTCGCGCCTGTTCCGGCGGCCAGACGGCCTCTTCCTCAACATCCACGAGG
TCGACCGGGTCTTCCGTGACATGTCGCAGTGGGGCCGACCCGAGGACATCGACTACATTGTCGTCACGGACGGCGAGGAG
ATCCTCGGCATTGGCGACCAGGGCGTCGGTGGCATCCTGATCTCGCTGGCAAAGCTGATCCTGACCACGCTGTGCGCCGG
CATCCATCCCAACCGCACTCTCGGCGTGGTGCTCGACTGCGGCACCGACAACGAGCAGCTGCTGAACGACCCGCTCTACC
TAGGCCTGCGCGAGAAGCGTGTCCGCGGCAGGCCCTATGACGTCCTCGTCGACACGTTTGTCAAGTCAGCCCGCAAGCTG
TTTCCGCGCGCGTACATCCACTTTGAGGACTTTGGCCTCAACAACGGTGAGTTGGTGAGGCAGCAGATAGACAGTAGGCC
CACTTGCTGATACGTGCAACAGCCAGACGCATCCTCGACATCTACCGGCCGCAGATTCCCTGCTTCAACGACGACATCCA
AGGCACCGGTTGCGTGACCCTGGCCGCCATCCTGTCGGGCCTCCACGTCAGCCACAAGACTCTTGCCGACCTGCGTATGC
TCATCTTTGGAGCTGGCACTGCCGGCGTCGGTATTGCCGATCAGGTGCGAGATGCCATCGCGACAGCAGGAGGCATCAGC
AAGGAGGAAGCTTCTCAGTACATATGGTCAGAACAAGCGACAAAAGACTCTGTTCTACTCGCATTTGCTAACCAATCTCT
GTAGGCTCATCGACAAACCCGGCCTGCTGACGAACGGCCTGGAGCTGTCCAGGGCGCAACAATCGTATGCCAGGGACCAG
GCCGAATGGGACGGCAAGAAGACAGACCTACTCGGCGTGATTGAGACCATCCATCCCAACGTGCTTGTCGGCACATCGAC
GGTACCGGGCGCATTCACCAAGGATGTGGTGCAGGCCATGGCGGCACACACGGATCGGCCGATTATTCTGCCGCTGTCCA
ACCCGACACGACTACACGAGGCGGTGCCGGCAGACCTGCTGGCCTGGACGGATGGCCGAGCGCTGGTGGCAACGGGGTCG
CCGTTCAAACCAGTGCGCGGCCCGTGGGGCGAAGACGGCGAAGAGGTGGAGTTTGAAATTGCCGAGTGCAACAACTCGGT
CGTCTTCCCAGGCATCGGACTGGGCTCGATTTTGTGTCGGGCCAGCCGGGTGACAGACCGGATGCTGGTGGCAGCCGTGG
AGGCCGTGGCCGAGCTCAGTCCAGCGCTCAAGGACCCGCGCAATCCGCTGCTGCCGGGCGTTGAGTCGGTGCGTCAGGTC
AGCGTATGCATCGCGCGCAAGGTCATCCACGCGGCCGTGGACGAGGGTGTGGCCACGGAGCACGACATCCCGCTGGACGA
CGACGAGCTGCTGGCCGAGTGGATCCGCGAGCAGATGTGGAAGGCCGACTACCGGCGGCTCAAGTGCGTGCCTGTGGAGT
ACGCTAGCTATGAGGCGTTGGGGCTGCAGCGGCAAGCCGGCACGTTTAGTCGTCGTGACAGCTGGGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62