GenePrediction:GLEAN_7744 Details

Name: GLEAN_7744
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:184681..180947 (- strand)
Length: 3735
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:184681..184625 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_140:184444..183928 (- strand)
Length: 517
Type: CDS
Source: GLEAN
Position: GCSC_140:183866..182061 (- strand)
Length: 1806
Type: CDS
Source: GLEAN
Position: GCSC_140:181989..180947 (- strand)
Length: 1043
>GLEAN_7744 class=GenePrediction position=GCSC_140:184681..180947 (- strand)
ATGATGGACTGGAGTGCGCTGCGTGGCGAACTCATCGTCAGCCGTGCCTCGCTCTTGGTAAGTGTCTCTTCCTTGGTCGC
TCTGGCTGTTGCTGGCTGTTGCTGGCTGTACTCTTGATATGCGATATGCGGTTTTATACACTTGTTTTTTTTTTTCGGCA
TCTTGCCTCGTGCTTTTTACCGGCTGCTTTTGCTTCTCTCTATGGCCATCTTACTGATAGACCTCGGACACGTTCAGAAC
GCGTCTGACCCTCGTGTCGGTTCTAGCCGAGACAACTCTACTGGCGGAACCCTCAGCCATACCACGACTGGTAGCAACTC
CAGCTCGGCCGCTTCTCTCGGCAGCACCTTTATTCCCGTTCTCGTCTTCTCGGCCGTCTGCCTCATCATCTTCGTTTCCT
TCCGCCGCAAATCTCCCCGAATCTACGCACCACGCACTATTCCTGGCATTCGCGAGGACCATGAGCTCACCCCGGCCCTC
CCCGACGGCTGGTTCAACTGGATCATCCCCTTCTTCAAAATCGACGACGCCTTCATCTTGAACAACTGCTCCCTCGACGG
CTTCTTCTTTCTCCGCTTCCTCCGCGTCATCGCCATCATCTGCTTCGCCGGCTGCATCATTGCTTGGCCCATCCTACTCG
CCATCGATGCCACCGGCGGCAATGGCGAGGTCCAGCTCGACCTCTTGACCATTGGCAATGTCGCCTACCCAATGCGCTTT
TACGCCCACGTGGTCATAGCCTACATTTTTTTTGGTAGGCAGCCTCGTCTGTTATGATGCTGGTGTCCTTCTCCCGTGCT
GACAATCTGTCCCAGGCTTCATCCTGTTCATGGTGTGCCGTGAGTGTGTTTTTTATATCAACATGCGACAGGCGTATCTG
TTAGCACCCCAGCACGCCCACCGTCTCTCGGCCAGAACTGTCTTGTTCACCTGCGTGCCCAAGCGCTTCCTCGACGAGCA
TCGTATCCGCAAGCTATACGGCGACTCCGTCAAGAACGTTTGGATCCCGACGAACACAAAGGACCTTGAGCGGCTTGTGA
AAGATCGCGAAAGTGCGGCTGAGCGACTCGAGATCGCCGAGATCGAGCTGATTAAGAAGGCCAATGCTGCCCGGAAGAAG
GCCATTGGGGCCGAGACCCTCCCGGCCTCTTCAAAGGGGATCGCACAGAGCATTCCACCCCTTCTTCGATCCTGGCCTGG
ACGCAAGAGACGCATCGCGAGCGCATCACGGAATTCTACCACCTCGTCCTCCTCCGCTACATCAGCAGCCTCTGCTGTTC
CTTCCGTCTCGCCTCTGACCTCCCTCTCGTCCTCATCCTCGTCCTCATCCTCATCCTCGTCGTTTGGCGAGACGGCTGCC
GGCCTCAGCAGCCCGCTCACCTCCGTCCCGAGCCATGCCAGCGGCGACCTCGCCTCGGCCGTCAAGACGGCCTTCCGGGA
GGAGACCATTGCCATCGACCGACACGCTTCCGTGTCGGAAGCAGCTTCAAGCCCATCGGCCGCCGACACCATTGTCGCTT
CGACACCAACGCCCACGGCAGATCTGGCCGAGAAAGACGAGAAAGACGAGAAAGACGAAAAGGATGGCGAAAAAGAGTAC
GACGACGAGGACGAGATGCACTACGTCCATCCCTACGGTTACTCGCCCGCCCTTCCCGATATTCGTGGCTCCGTGGCCGC
ACAGTGGCTACCGGCCGAAAAACGTCCGGGCCACCGGCCATTGTCGAATTACGGCCGCCGCGTCGACACGATTCGCTGGA
CACGCAACCGGCTCAAGACGCTCAACCAGGCCATTGCTCGCACGCGACGACGTTATCGCAACGGCAACGGCGATCCTCTC
TCGGCTGTCTTTGTCGAGTTCGACACGCAGGCTGCCGCCCAAGTCGCCTTCCAGGTTCTCGCCCACCACCAGCCGCTGCA
CATGTCGCCGCGTTTTATCGGCATCCGCCCCAACGACATCATATGGTCGTCACTGCGCATGAAGTGGTGGGAGCGCATCA
TCCGCCGCTTCGCCATGATGGGCGCCGTCAGTGCTGGCGTCATCTTCTGGTCGATCCCTTCCGCCTTGGTTGGTATCGTC
TCCAACATCAAGTTTCTCAGCAGCAAGTTCTTTTTCCTCCACTGGCTCAACGACCTGCCGGCTGTCATCACCGGTGTTAT
CGAGGGACTGTTGCCGTCGCTGGCTCTCTCCATCCTGATGGCGCTCGTCCCGGCGATGCTGAGAGGAGCTGCCCGGACCG
CCGGAGTGACGTCCGTCCCCATGGTTGAGCTCTTTACACAGAGCGCATACTTTATCTTTCAGGTCGTCCAGGTATTCCTG
GTCACGACACTGACCTCTGCTGCGTCGGCAGCCATCACACAGATCCTCGAGGACCCCCTCTCGATCAAGGATCTCCTCTC
CTCGAACCTGCCCAAGGCCTCGAATTTCTATCTATCCTACATCACTGTGCAGTGTCTGGCTGGCGGTGCCTCTGGACTCC
TCCACTTTCTCGACCTCTTCCGCCACGGCATTCTGTTCAAGACTATCGAGGACCCCAGACGGGCTCATAAAGTATACCAC
ACGCTCAAGAGACCGCATTGGGGAAGCATCTTCCCTGTCTACACAAATATGGGAGTGATCGGTAGGTGTCTCTCTCCTGT
TGTATTGACCAAGAACTTTGGCCCGGCTAATGTGCGTCTTTCACGTATTCAGCGATCAGCTATGCCTGCATTGCTCCGCT
CATTCTCCTCTTTGCCGGTCTTGGCATGGTCTGTTCGTACCACGTCTACCGGTACAACCTCCTGTACTACTTCGACGTCG
ACGTGGATTCCAAGGGCTTGCACTATCCCCGTGCCCTGATGCATCTGCTGGTCGGCCTGTACATGGCGCAGATCTGCCTG
ATTGGTCTTTTTACCCTTCAAACTGCCATCGGCCCAGTTGTCTTGATGGCTTTGTTCTTGATCTTCACCATCATTGTGCA
TCTGTCGCTGAGCGATGCGGTGAATCCACTGCTCACCTCCTTGCCGCGCACGCTCGCGTTGGAAGACAGGGACCTAGCCC
GCACAAATGCCGAAGACCGAATGGAGGCGGAAGAGCCACGAATTGACAGTGGCGCCGGCCTGAACTCAGACTACTACGAT
CTCGAGGAAGGCTTTGGCGAAGAGGAGGCAGACGACAACCTCCACGAGGGTCCTGTGGGAACTAGGAGCGGCATCGGCAT
CGATGGTGCCGGCGGTCTGTTCAGTATCTTCAAGGACAGCACGGCATCGGCCCTCAAGAAGAGCTTCAAGACGGCAATCA
AGGCAGTCAAGGACGATACTCGAGAGTCTCGCTTCGGCCTATATGTACCGTGGCTGAGGCCGAAGAGAGCCGATGTGGAC
GCCAGCCGCGATGGTACTGGCGATCCTAGCAGCAGCGAAGAAGCTGCCAAGAAGAAGCCCAACATCTTCATCCGCTGGCT
GCACCCGGAAGTGTACGAGGACTACTCGTTCCTGCGGAAAATGCTGGCCGTGGACGTGCCCGAGGTAGAGTACCCGGATG
ACTATGCGCGGCGTGGATACTGGCCGCCCGAGATGTGGAAGCCGGTTCCGCGAGTGTGGGTGCCACGAGACGAGGCGCGG
GTCAGTCGCCAAGAGGTGGCGCACTCGGGGCTGGTGGCACCCACTACCGACCGGGGCATCTGGCTGAACTCAAAGGGACG
GGTGGATTTCGATCTAAGCCAGGCGCCGTTTAAGGAGCCGCGGTTTGTGTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62