GenePrediction:GLEAN_7748 Details

Name: GLEAN_7748
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:156781..154851 (- strand)
Length: 1931
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:156781..156681 (- strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_140:156615..156355 (- strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_140:156286..155877 (- strand)
Length: 410
Type: CDS
Source: GLEAN
Position: GCSC_140:155805..154987 (- strand)
Length: 819
Type: CDS
Source: GLEAN
Position: GCSC_140:154927..154851 (- strand)
Length: 77
>GLEAN_7748 class=GenePrediction position=GCSC_140:156781..154851 (- strand)
ATGAGCGTCCAAGAGCTGCTCAAGAAGCAGCTAACAACTCCGAAGCTGCTGTTTCATTTTCTCTTCTGGAGCTTCCACTG
GGGAATGTTCGCCTTTGGATGGTGCGTAGAAACGGTTCTTCTGGCCCTATGGTCTTGCTGCTTTGCTCTTTTTGGTGCTG
ACACAGGCGCAGGCACAAACAAGCAACAGATCCTCGACTGGCTGGTCTGAACACACTCACATTCTCCGTCTGGATTTCTC
GGGGTGCCGGTCTCGTCTTGGCAATCGACGGCACCCTTATTCTGCTGCCCGTCTGCCGGACGCTCGTGCGGATTGTGCGG
CCAAAGGTCCGGTTTCTGCCTCTTGACGAGAATATCTGGTTCCATCGGCAGGTCGCCTACGCCTTGCTGCTCTTCGCCAT
CATCCACACGGCTGGCCACTACGTCAAGTAAGTGCCTTGCGCCATCGTCAGCCGTCTCGGCTCCTTCTGAATGTCAGCAC
TGACCGTGTACACAGCTTCTATAATGTCGAGCTGAACCAGGTTCGCCCTGTCACAGCAGTGCAGATTCACTACACGCAGC
CTGGCGGCATTACCGGTCACATCATGCTGCTCTGCATGCTGCTCATGTACACGACAGCCCACGCCAAAATCCGGCAGCAG
TCGTTCGAAACGTTCTGGTACACGCACCACCTGTTCATTCCCTTTTTCCTCGGCCTGTACACCCACACCGTCGGCTGCTT
TGTGCGCGACACTGCCGACGCCGTGTCGCCTTTTGCCGGCAAGAAGTTCTGGGACCACTGTCTCGGCTACGAAGGCTGGC
GATGGGAGCTGTTTGCTGGCGGCCTCTATCTGGTGGAGCGTCTGTACCGCGAAGTCCGAGCCCGCCGCCAGACCCGCATC
ACCCGTGTCGTCCGCCATCCGTATGGTAAGTGGGAAGTCAAAGCCGGACGCGAATCCGACAGTAGCGCAAAAGCTGACCA
GTCCTTCTCCTTCCAGACGTTGTCGAGATCCAGTTTGCCAAGCCGTCGTTCAAGTACAAGGCCGGCCAGTGGCTTTTCCT
GCAGGTGCCCTCGGTGTCCAAATACCAGTGGCACCCGTTCACGATCACGTCGTGTCCGTACGACCCGTACGTCTCGGTGC
ACGTTCGGCAGGTCGGCGACTTCACGCGGGCGCTTGGTGACGCCATCGGTGCCGGAGCCGCCCAGTCGAAGCTGTACGAG
GGCGTGGACCCGATGGGCATGTATGAGGTAGCGCTGCAGAACGGTCAGCAGATGCCGACGCTGCGCATCGACGGCCCCTA
TGGAGCGCCGGCCGAGGATGTGTTCGACAACGAGATTGCCGTGCTGGTTGGCACGGGCATCGGTGTGACGCCGTGGGCGT
CGATCCTCAAGAACATCTGGCACTTGCGCAACGGGCCCAACCCGCCGACGCGGCTGCGTCGTGTCGAGTTCATCTGGGTC
TGCAGGGACACCACCTCGTTCGAATGGTTCCAGACGCTGTTGTCGTCGCTCGAGCAGCAGTCGGCCGAGGCGGCACGCAT
TCCAGGCAGCAACGGCACCGAGTTTCTCCGGATCCACACGTATCTGACCCAGAAGCTCGACATGGACACGACACAGAACA
TTGTGCTCAACTCCGTCGGTTCCGACCACGATCCGCTGACCGAGCTCAAGTCGCGCACCAACTTTGGCCGCCCTAACTTT
GACAAGCTGTTCTGCACCATGCGCGACGGCATTCTCAACCGCACCTATCTCAACGGCCTCGAGGGCAGCGTGAGGACCAC
CGTCGGTGTCTACTTCTGCGGACCGTCTGCAGCAGGTATGTCACCATCGTTTCTCTTCTTTCCTGTGGCATCGGCCTTGC
TAACACTCTTGCAGCACGCGGCATCAAGAAGGCAGCTGAAGCAGCATCTGTTCGGGAAGTCAACTTCCGCTTCTGGAAGG
AGCACTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62