GenePrediction:GLEAN_7751 Details

Name: GLEAN_7751
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:150099..149004 (- strand)
Length: 1096
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:150099..150011 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_140:149919..149004 (- strand)
Length: 916
>GLEAN_7751 class=GenePrediction position=GCSC_140:150099..149004 (- strand)
ATGGACTCATCGGCTGCCGACCGCAGTCTCCTCGACCGTCTCAACGCTCTGAAGCCGTCCGGAGTGGTTCTGGACAGGCC
TTCGCAAACGTAATGTCTTCTAACGTCTTCGGCACAACGACGACGCATTGTTAACCTGCCATCGTGTACAAAGGTCGACT
ACTTCACATGTGACCGACAGTGCTGCAGATGCACCAGAAGCACGTGCAGATGCGCTCGCTGCTCGGCTGCGGCTGCTCCG
CCAGCACAGCGAACCCCAGGCTGATGGTAAGCGCCAGGTCGTCTCCAACGCGGATCCTTCGTCTCCTTTGCCACCAACCG
CGCCGTCAGCGGTACAGGGCCACCATGACGAGGACGACGACCCGTTGCTCTTCTCTGATGAGCGAGCGCTCAACGACTTT
TTGTTGGATGACGAGGACGACGACAACGGCAGCTTCGTATTGCTGCCGGACGTGCCACGGCAGCTTAGCCAAGATGCGGA
CGATGCAGATGATGCAGATGACGAGAAAAAGGTCGCTGATTTGCTAGGGAGCCTGGCCGGACCTGGAGCCGAAGGCAGCC
AGGCCCAGCCCAGCTCCCGCCGCTCAGACGAGTCGGACGAGTCGGACGGTGACAACATGGACCGCGAGGTGCGTCGTGTG
GTGAGCCAAGCCCGAGATGAAGCTCGAGCCGATGCCGGTGAGCCAGACGACTCCTCGGATCTGCAACTCCCCGCCGTCCC
GACAGAGCTCGTCGACCGGCCGGAACGTGATGCTGCCGACGACATCGCCGAGCGCCTTGCTGCCCTCCGGGGCCTCAGCG
GTCCCGATGCCGGCCTCGGCCACACGGACGCCTTTGGCCTGCCGTCGGCGCCAACTTTTCGCCCAGGCGACGACAGAAAG
AAGCCCGGCAGCAGCAGCAGCCGCTTCGGCTACACCGAAGAGGACCGCCGCTCCTGGTGCGTCGTCTGTCTCGAGGACGC
CGCCGTGCGTTGTCTCGGCTGCGATGACGACCCCTACTGCGCCCGCTGCTGGCGCGAGATGCACGTCGGCCCTGCTGCAG
GATTCGACGAGCGCGGCCACAAACGCGTGCCTCTCTCTCGGGCCAGCCAGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62