GenePrediction:GLEAN_7752 Details

Name: GLEAN_7752
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:146312..141791 (- strand)
Length: 4522
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:146312..143877 (- strand)
Length: 2436
Type: CDS
Source: GLEAN
Position: GCSC_140:143802..142389 (- strand)
Length: 1414
Type: CDS
Source: GLEAN
Position: GCSC_140:142326..141791 (- strand)
Length: 536
>GLEAN_7752 class=GenePrediction position=GCSC_140:146312..141791 (- strand)
ATGCAGTGCTACACAGAGCTCACGCCGCCGACGGCCGTCACGCACTCGCTCGCCCTCCCTCTGACCTCGCCGCGTGCCAA
CAATCTGATCGTGGCCAAGTCGTCGCTGCTGCAGGTCTTCACCACCAAGGTCGTGTCAGCCGAGCTAGACGCGCCGCCCG
ACGCGTCGTCCACATCGCAGGCTCCCTACGCCTCGGCAACCAACTTTGACAGCCGCATCGCCAACGACGACAACGGGCTG
GGACTCGAGACGTCCTTTCTTGGCGGGGACTCGATCCTGCTTCGCGCTGACCGTGGAAGCATCTCGAAGCTAGTCCTCGT
GGCCGAGTTTCCGCTCGCCGGCACGGTCACTGGCCTGGCCCGCATCAAGATCCCCGGCACCAAGTCGGGCGGCGAGGCCG
TCTTGGTCGCCCTCAAGGACGCGAGGCTGAGCCTGCTCGAGTGGGACCCAGACCAAAACGACCTCACGACCATCTCGATC
CACTACTACGAGCAGGAGGAGCTGCAGGGCGCGCCGTGGGCCGCCCCGCTGAGCGACTATGCCAACTTCCTCGTGGCCGA
CCCGGGCAGCCGCTGTGCAGCTCTCAAGTTCGGCGCCCGCAACCTGGCCATCCTGCCCTTTCGCCAGGCCGACGAAGAGG
ATGTCGACATGGACGACTGGGACGAGGAGCTGGATGGACCGCGGCCTGCAAAAGATCCCTCCTCGGCGGCTGTTGTCAGC
GGCCCTGGCGACGGCATTGAAGACACCCCATTTGCTCCCTCCTTCGTCCTGCGGCTCTCCAACCTCGACACCACCCTCCT
CCACCCGGTCCATCTGGCCTTTCTGCACGAGTATCGCGAGCCGACGTTTGGCATTCTCTCGTCCTCGGTGTCCACGTCTG
CCGTCATCGGCCGCCGCGACAAGCTCTCGTACCTGGTCTTCACGCTGGACCTACAGCAGAAGGCATCTACTACCATCCTC
TCCGTCGCCAACCTGCCGCAGGACCTGTTCCGCGTTGTCCCCATTCCGTCACCGATCGGAGGCGCCATTCTTGTCGGCGC
CAACGAGCTGATTCACATCGACCAGTCTGGTAGAGCCAATGGCGTGGCTGTGAATCCCTTCACCAAGCAGAGCACGTCGT
TTGGCCTGGCCGACCAGTCCGATCTGGCCCTCCGTCTGGAAGGCTGCACGGTTGACGTGCTGTCTGCCGAGGCGGGCGAG
CTGCTGATTGTGCTGCACGACGGGCAGCTGGCCGTCCTGACCATCCGCGTGGACGGCCGTACGGTGTCCGGCCTGAGCGT
GAAGATGGTCCGCAGGGAAGCCGGGGGTGATGTGATCCAATCTGGCATTACTTGCCTCAGCCGCATCGGTCGCCAAATGC
TCTTTGCCGGAAGCGACCAGGCCGACTCTGTGGTGCTGGGCTGGTCGCGAAAGCAGGGCCAGACAGCGCGGCGCAAGCCT
CGTGCCAACAGGGCCGGCCTCGATCTCGGAGCGGACGAAGAATACTTTGACGACGAGCGGGAAGAGGGCGAGGAGCTGGA
CGACGACGAAGACGATGATGATCTTTACGGAGACGGTCCATCGGCCGCACAGACGCTCGGGATCGACAATACGACCGGAC
GGGGTGGCGACGACCTGAGCTTCCGGATCCACGACCGGCTGCTGAGCATCGCACCCATCCGCGACATGGTCATCGGCAAG
CCAGCACTGGTTGGGGAACTTGCCAAGCGGAGCGATCAGGCCACGATTCACAGCGAGCTCAACCTGGTATGTGCTGTTGG
AAGCGGACGGGCCGGGGCGCTGGCGCTGCTGAGCCGCGAGATCAACCCCGATCCTCTCGGGGCGTTTGAGTTTGCCGAGG
CGCAGGCTCTCTGGACGGTGTCATCCTCAAAGCCGATTCCCAGGACGATACAGGGCGAGAAGGGTGGTGCGACAGTGGGC
GAGGACTACGAGTCGCCGGCTATGCACGACAAGTACATGATCGTAGCCAAGGAAGACGACGACGGATTTGAGACGTCAGA
TGTGTATGCAGTGACTGCTTCGGGCTTCGAGACGCTCAAGGGCACTGAGTTTGAGCCTGCTGCAGGCTTCACGGTCCAAG
CCGGAACGATGGGGCGGAACAGGCGGATCATCCAGGTGCTCAAGTCCGAGGTGCGCTGCTATGACGGCGACCTCGGGCTG
TCGCAAATCCTGCCAATGGTCGACGAGGACACCGGGGCAGAGCCGCGGGTGTTGTTTGCCAGCATTGCCGATCCGTATCT
GCTGCTGATCCGAGATGACGCAAGCGTGCTGGTGGCCGAGATGAACAAGGACTTTGAGCTGGAGGAGCTCGAGAGGGACG
ACGGAAGCCTTGCGTCGACCAAGTGGGTGGCCGGCTGTCTCTACCACGACACCGCCTCGGTCTTCTCGAAGACGAGCATC
CTGGCCTTCCTGCTCAGTGCCTCAGGGACGTTTTACGTAAGCGATCTTGAAGGTGCATTCACGTGACTGTTGTGTAACGT
GAGGCTAACTGCTCCTTCTTCTCCTGCCAGATCTACGCTCTTCCCGACCTCAAGCAGCCCGTGTATGTGGCCGAGGGACT
CAACTACGTCCCTCGGCTGTTTCTGCCAGACCACACAGTGAGACGGGGGATGGCTAAGGAGCCGTTGACAGAAATCCTGG
TTGCCGATCTCGGAGACGCAGTGTCGAAAGCGCCGTACCTCATTGTCCGCCATGCCAACGACGACCTGACAATCTACCAG
CCGCTCCGAACGCCGTCTTCATTGGGCAGTCTGTCGGAGAGCCTCCGGTTCCTGAAGGTGCCGAACCCAGTATTTGCAAA
GAGTCCAGTCTCTATCTCGTCGGACGACGCGTCGTCGCAGCTTCGAGCGATGCCGTTGCGTGTCTGCGAGAATATTGGCG
GCTATAGCACAGTGTTCTTGCCGGGTTCGTCGGCCAGCTTCGTGCTGAAGTCGGCCAAGTCGCAGCCGCGGGTGGTCAGC
CTGCAGGGCACAGCGGTCCGGAGCCTGAGCCCCTTCCACACAGAGAGCAGCGAGCGCAGCTTCATCTACGTGGACGTTGA
GGGGTCGGGACGGGTGTGCAGCATGCCAGCAGGCTGGAACCTGACGGAGCTGGGCGTGTGCGCGCGCAAGGTGGCGCTGG
ACACGGACGCCAACGCGTTAGCATACCACCCACCGACGGGAACGTATGCCGTCGGGACCAGCGCGCTGGAGGCGTTTGAG
CTGCCCAAAGACGACCCGCACCGGGCAGACTGGAACAAGGAGAGCACGGCGTTCCGGCCTCTGGCCGAGCGGGGACGGCT
GCTGCTGATGAGTCCGGGCAGCTGGAGCACGATCGACACGGTGGAGATGGAGCCGTACGAGGTGGTCATGTGCGTGAAGA
CGCTGAACCTGGAGGTGTCGGAGGCGACGAACGAGCGAAAGCAGCTGGTGGCAGTGGGCACGGCCATCTCGCGCGGCGAA
GACCTGGCAATCCGCGGACGGGTGTACGTCTTTGACGTGGTGTCGGTGATCCCGGAGCCGGGACGGCCGGAAACGAACCG
GAAGCTGAAGCTGATCGCCAAGGAGGACATTCCACGCGGCGCGGTCACGGCCGTGTCTGAAATCGGCACGCAGGGATTGA
TGCTGGTGGCCCAGGGCCAGAAATGTCTCGTGCGTGGCCTCAAGGAGGACGGCACACTGCTGCCGGTGGCCTTTATGGAC
ATGAACTGTTACGTGACCAGTGCCAAGGAGCTGCCCGGCACCGGCCTGTGTGTCATGTCAGACGCCTTCAAGGGCGTCTG
GTTCACCGGGTACACCGAGGAGCCCTACAAGATGATTCTGTTTGGCAAGAGCAACACGCGGCTGCACGCCCTCAACGTCG
ACTTGCTGCCTGACGGCAAGGAGCTCTTTATCGTGGTCACCGATGCGGACGGGAATCTGCACGTGATGCAATTTGATCCA
GAGCGTAAGTGAAGCGAAGGGAAGAGCGCATGTTGACCAGTCTGTTCACTAACAGGTCTTTTGCAGACCCCAAATCTCTG
CAGGGACACATCTTGCTGCACCGGGCCACCTTCTGCACCGGAGCCCACTTCTCGACCCTGTCGCTGCTCCTGCCGTCCAC
CTTCACGCCGGCCGACCGACCGACAGCCAACGGAGAGACGAACGGGGCCTCCAGCCAGCCGGAAGCGCAGCAGCACCAGC
AGCACCAGCTCCTCCTGGGCAGCCCGACCGGTCTGCTGGCCTCACTGGTGCCGCTGTCCGAGTCGGAATACCGGCGGCTG
TCGTCGCTGGCCGGACAGTTGGCCACGTCGCTCACCCAGACGGCCGGCCTCAACCCCAAGGGCTACCGGATGACGGCCGG
ATCGGCGGCAGCAACATTGGCGCCCGGCGTGGACGCAGCCGTGGGTCGCAGCGTGGTCGACGGAGCCCTGCTGGCCCGCT
GGACCGAGTTGGGGTCGGGGCGCAAGGGCGAGATCGCCGGACGCGTCGGGTTCGCCAGCAGCCTCGAGGTACGGACGTCG
CTCGAGGGCGTGCTTGGATGGTCGCGCATGGCGTACTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62