GenePrediction:GLEAN_7754 Details

Name: GLEAN_7754
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:127822..126687 (- strand)
Length: 1136
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:127822..127564 (- strand)
Length: 259
Type: CDS
Source: GLEAN
Position: GCSC_140:127503..127263 (- strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_140:127206..126687 (- strand)
Length: 520
>GLEAN_7754 class=GenePrediction position=GCSC_140:127822..126687 (- strand)
ATGGCATGCTTGGTGGACTACTCGTCGTCGGCCGGCGAAGAAGATGAGGACAAGACAGCGGACGTGACGAAGCGGACCAG
CCTGGAAGCGGCTGCAGCTGCACCCCCTGCAAGCCTCCCCCCACTGCCGCGGTCCTTTCATGACATCTACGCCGCAAATG
TCCGCACCAGCACTGCCGACTGCCCCAGCCTGCACCAGGGTCGCACTCGGGCAATTCCCCACGTCGCCGGCCAGTGGCCG
AGCCACATCTACGTCGAGTGTAGGTTTCTAGACTCTTCTGCCCTTGCCATCATACGACTGACGTTTAGTCCGTATGCAGG
GTTCCCGACGTCGCCAGAGCACGCGTCTTTGGAGGCACTGCTCACTGCGGTCATCGACGTCCTACCCCAGACGGGCAATC
CGCCCGGACGGCCGGCTGTTCACAGCCTGCTCACCAGCGATCTCGGCGTGCCGTTGCCGCTGCACATCAGCCTGTCGAGG
CCGTTTGTGCTCCGTACGGCACAGAAGCCGACTTTCCTCGATAGCCTCATCGCTTCTGTGTCGTCGTCGCGTGTTGTGCC
GTATGTTCTTTCGCTCCCTCTCTGCGCACAGCTTCACCCTTCTCATATGTTCCCAGATCTTACGTCGGCTTCAATGGCCT
CGACTGGTATCGCAGCCCCGACTCGGCTCGCGCATTTCTGGTGCTTCGGGTTGCGGTCACCGACAAGGCCGCTGTGGCTG
ACGTAAGCAAAAGCAGGGGCCGCGGCCACAACCACCCGCTGGTGTCTCTGCTGGCGCGGTGCAACAGCCAGGTTGCATCT
GTGGGCCAGCCAACCCTGTACGGGCAGAGCACCGCCTCCGAAAGCGACGAGGACGACACCGTCGCCTTCGCCTTTCACGT
CTCCGTCGCCTGGACATTGGCAGATGACATTCATGCCTGGGTAAAGCTGACCGAACAGGCTTATGGCACGTGGCAGCAGA
ACCAACGCAAGGAAAGCAAGGAACCGCTACACTTTAACGTCGATAGCGTCAAGATCAAGATCGGCAACATCGTGTCAGAC
ATCCCACTGGCAGCCAGCGAGCGGCGAGCTAAGAGGGCACGAACAAATACAGGGCCCAATCACGGGCCAAGAAAGAAGCT
TTCTGGCCTATATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62