GenePrediction:GLEAN_7755 Details

Name: GLEAN_7755
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:121159..118800 (- strand)
Length: 2360
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:121159..121047 (- strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_140:120986..120270 (- strand)
Length: 717
Type: CDS
Source: GLEAN
Position: GCSC_140:120212..119948 (- strand)
Length: 265
Type: CDS
Source: GLEAN
Position: GCSC_140:119878..119287 (- strand)
Length: 592
Type: CDS
Source: GLEAN
Position: GCSC_140:119227..118800 (- strand)
Length: 428
>GLEAN_7755 class=GenePrediction position=GCSC_140:121159..118800 (- strand)
ATGGCTGACACAAACAAGCCACAGGAGGAGCGTCGCAATGGCGAAACGGCAGCGTCGACGACAGAGGTTGGCCTCGCCTT
TCTCGAGCAAATACGGCGAACGGGGGACAAGAGGTGAGTCGTCCACGGCCAGCAATGCAGGCAGTCTTTGCGGCGCCTAA
TGTGCAATTGCAGCGGCCGTCGCGTGGCCAAGTACTTTGAGGAGCTGCTCCCAAAAGAAAGCAACAAGGAATACTATCAG
GCCATCCGGATGCCCATCTCGCTTGGCACGATTGAGACGAAGCTGCGCAATGGCGACTTTGCCAACCTGGCCGAGCTAGA
ATCGTATGTGAAGCGCATGGTGCAAAACGCAAAGGACTTTTACCCACGGTCATCACATACATACGACGACGCCGAGCGGA
TTCGGAAGGCCACGAGCAACTTCATGGTGAAGCACAACCCGGCCTACAAGCTGATTCACGGATATTCCGCGCTTCCCACC
CCCATCCCGGTCGATCTTCCGGAGGAGTCACCGGCAGAGGACGATGCGGAGGAGGAGGCAGCAGATGACGGACCGGAGGC
AGAAGTGGCTGAGGAAGACGGTGATGTCGGCGCAGGGGCCGACTCGGAAGCGGAAGAGGCAGATGCCCACGAGTCTGAGG
AAGAGGGAGAGGAAGACGAGGCAGACGGCGACGAGGACGACGATGCCAGGCCAGCATCGCGCCGACCAAATTCCTCAACG
GCTTCGCGAGAGGCATCACTGCGTGGACGGCGCAAATCGACAACAGAGCGGGCAACCAGCGTCAGTGCGAAGCCAGACCA
CGAATATGCCGGTGTGCCGTACAAGGGCCTCACCTTCCAGCAGGCGCAGGAGAAGATTGTCGAGGAGGCGATTCGACGTA
CAGACGAGGAGTGAGCTACGATACACAACCCCTGCAGTCCCTGTTTCGTGTGCTAACAACATGACAGCGACGACAGCTAT
GCCTATTTTGAACCCTTCCTAAACCTGCCACCCCGCTCGCTAAAGGACTATTTCCAGCTGATCAAGGATCCGCTGTCGTT
GAAGAAGCTGCAGAAGCTCGTGAAGGGCATCCGTAGCCGATCGGACCGGTCGGGGGTCAGCGACTTCAAGAACTGGGCCT
CGTTTGAGGAAAAAGCCAGCCTGCTGTGGGAGAATGCATACTTTTACAACGAGGACAAGAGCCCGATCGCCAACATGGCC
AAGGAGCTAGAGGTAGGATTCCATGTCAACGTTTCTACGGGTGGGAAATTCGGTCGCTGACTTTTGCGCGATGCTCTGCA
GATCATGTTCCGGGGCGAGATCAAAAAGGCCAAAGAGGTGGTTTCCGATCCGCCACAGACAAAGATTAAGATCAAGATGA
CCCAAGGCCAAGAGACGCCGGCGCCAGCATCGAAGAAGATCACGATCCACGTTGCCAATGCCCGCGGCGGCTCCACCGAA
TCGCCGGGCCCGAAGTTGGTGGGCGGAGGAGCGCCGACCACTCTAGCCTCACACCCGGCGCTGGAAAGGACGAGAAGCAC
ACCCGGCGTCTCTCCGAGTCCGTCTGTCGTGGCCAGCACGAAACAGGAGACCTCAGCACGCGCGTCGCCTGCGCCGCAGC
AGCGTCCCAACGGGGTGCCTGTAGCAGCAACCCTGCCGAACGGAGCAGCCGCGCCAGCAGCAGTTCAGAACGTGCAGACA
ACTGACGCTCCCGGCACGCCTCAGACAAACGGAAGCACGGCTCCAGTTCCGGCTCCGGTTCCGGCTCCGGTTCCAGCTCC
GGTTCCAGCTCCGGTTCCAGCTCCGGTTCCAGCTCCGGTTCCGGCCCCAGCTCCGACGCCTGCGGCCGTTGTACGACCTG
CTCATGAGTCCAAGTTCCGCGAGCCAGGCCGAGGTACGTTTATTCTTTCTGTTTGTCACGAGATACGTGTTTTGTTGACA
GACGCGTGACAGAACCCCTGATCACCAACTTGGCCATGCGGACACACCCTACGATCAACACGGGTGACCGGCTGTTCGAG
CTGAAGCTGCCGCCACACCCCAAGCTGACGCAGCGGTCTGTGACGCTGAACATTCCCCAGGGCCAATGGCGCCATCAGCT
GATCGTCAGCCTGGCGCCGTCGGTGCAGCAGCAACAGCGGCCTTTCAAGCTGTTTGTGATTGCGAACGGTGCGACTTTGG
GCCAGTCTGCGCCCCTGGCTACGGCCCCAGCAGATCCGGCAGAGGCGGGCGGCAAGCTATACGAGGTCAACCTGCACCCC
GGCGTCAACGTCATCCAGGTGCAGGTGATCGCGGGGCTGCCCAAGGACCAAGAGCCGCAGAGTGGCGCCGAGGCCGAGCT
GGAGAAGATTACGATTTTTGCCAATCTCATGCGGTATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62