GenePrediction:GLEAN_7758 Details

Name: GLEAN_7758
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:100260..97935 (- strand)
Length: 2326
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:100260..100090 (- strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_140:100011..99253 (- strand)
Length: 759
Type: CDS
Source: GLEAN
Position: GCSC_140:99176..97935 (- strand)
Length: 1242
>GLEAN_7758 class=GenePrediction position=GCSC_140:100260..97935 (- strand)
ATGTCTATGGCCTCTACGCCCGGCCAGCCTTCAGGCAGCCAATACTCTGGCAATTACCCCTCGCCCGCACTGCAGAACTC
TTCCAAACCGACGCGAATTCTGGCTTGCGTCCTATGCCAACACCGAAAGATCAAATGCGACCGCTCGTTTCCCTGTGCCA
ACTGTGTCAAGGTAAGCTCTGCCACCCGCTTGCGATACTCTCCCGTCGTACCGGAAACACAACCGCATGCTTACCCCCGC
TGCGGATAGGCCAATGTTACATGCACACCAAGCACCCCTGCTCCAGCTCGAAAGAGGCGGCGCCCCAACCAGGACCTACA
GGAACGCTTGGCCCGTTGCGAGGAGCTTCTCAAAGCTTATGCCACAGAAAAGCCGGGTGGAGATGCCTCATTTCTGAATG
GCCATGGCTGCCAATTGTTCGGGGAAGAGTCATCTTTGAAGTGGAAGCCGCCTGGCAAGCTCATCGTAGAGGACGATGGC
GGGGTTCGCTTTGTCGATTCGTTCATGCTTGGGGCCATTCACGACGAGCTGCGGGCCATGCGCGAGATCATCGACGACGA
GGACAATGACGATACAACACCAGAGACTGTTGCAACGCCAGACGACAATGCCAATATGGTTTTAGGCGCCATGCACGCCA
CTATCACCACGCAGCCAACTCTCGAGGAGCTTATGCCCCCTCCGGCACTCATATTTCGGCTGTGGCAGATCTACCTCGAA
CGCGTCAACCCACTCACCAAGATCATTCATGTGCCTACCCTGCAGCCGTATGTGGCCGAAGCCACGAGTGGCGGCCACAA
CGTTCCGCAGAATATCAAAACGCTACTATTCTCCATCTACACTCTGGCGACCGTTTCCATGACGAATGACGAATGCCTCA
ACTTTCTTGGCTACTCGCGGCAGGCCGCTTTGGAACGCTTCTCCGAAGGTGTTCGCCAATCCCTCATACGCCTGGGCTTC
CTCAAGGCCTACGATATTGAAACGCTGCAGGCGTTAGTCATTTACCTAGTAAGCACTACCCAACATACCAGTGCTTACGC
ACATGTAGCGCTTGACACTCACAGGCTGTCAGATTTCTCTCCAGGGCCGGTACAACCGACATGCCGCCTGGATATTAAAC
GGCGTTGTGCTCCGTATCGCTCAGAAAATGGGCTTGCATCGCGACGGCGAGGTTCTTGGCCTGAGCCCATTTGATACGGA
GATCCGGAGACGCCTGTGGTGGCAGATCATCATGGTCGACGCCAAATACGCACTGATGTCGGGTCTGAGTCACTCGATGC
TGCCCCATCTTTGGGACACAAAGGAGCCCAGTAACGTGAACGACGCCGATCTCCATCTGGCTTCGACGGAGCCAGTGCAG
AACCGTGAAGGGCCGACGGAGATGATCATGGTGTTGCTCATGAGCCGGGTTGCTCGGTTTCTTCTGCAAACGCCAGGCAT
CGAGCCCATGTTTCTCCTCGGCGAGACGGACTCGTTCATGGACATTGGCGGGCCGAGCCCGGAGCAAATTGCGATATACC
GGCAGATGATCACAAATCTCGGCAACAGCCTTCTCGAGGTTATCGATAAGTACTGCGACCCCAGTGCTGGTCCTCTGCAC
GAAATGGCCATCGATATCAAAGCCGATATCCTAGACAAGATCGAAACCTTGTTGCTTCCACCAGAGGAAAAAACGTTTAC
AGATGAAGTCAAAACTCCAGCCGACACTGTCTTCAGGATCAGTGTCAGGGCCATCCAGCATGAAAACAAGCAGCTTGTGA
AGACCAGAGCCAAAGGGTTCTCCTGGTTTTCGCGGTTGGATTTTCAAGTCAACATCTTCCTGTTTGTCGTTGGACAACTG
TGCTCGCGAACGTCCGGAAGGTTGGTCGAGATGGCCTGGGAGGCTGTACAAGCAACATACGAGAACTACGAACAGCTTCT
TGACATCACACAACGACCTCACTACCAGGCCGCCTTGTACGTGCTTAAGGCATGGAAAGTACGAAGGGAAATTCTGCGCA
TTCGGTCGGGTGGATTGACGGCAGAAACGCCGGATTACATCCTCAAGCTACAGTGTTCCATGCCACCACAAGACGATTCG
AAGAGCGACCTGGCATCGATGCCCGCATCCTCGGTTGTGGCGCACTCAGTCGACATGTCAAGATCGGTCGAAACACCCAA
AATAGAAACAGGCCCGGATGCGACACTGGATCAATTTTTTGCTCAGCCATATATAGATTCGAACATAGATTGGGACATGT
GGGGGGCTATTATGCCGACCGAGGCCAATGCGTCGGCATTCGATGGATTTGGTTCGATAGATGTGCCACCAGGCACACAA
TGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62