GenePrediction:GLEAN_7759 Details

Name: GLEAN_7759
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:95346..91950 (- strand)
Length: 3397
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:95346..95299 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_140:95207..92174 (- strand)
Length: 3034
Type: CDS
Source: GLEAN
Position: GCSC_140:91981..91950 (- strand)
Length: 32
>GLEAN_7759 class=GenePrediction position=GCSC_140:95346..91950 (- strand)
ATGGCCCGCGGCGCGGGCTACCGTAGTCGCTTGCCGAGGGGCACAATGGTATAACTCTTCGAGCTATCAGCGCAACCCTC
GGTTACCAGCCTTGGTCCCAGGTTCTATTGGCCCCAGTACGCCTCTAAAGAATCTGCAGCCTCTTCAGCTTGTCCGCCGT
GCCTCGGTGATTTCTGATGATTCTGCTGCTGGATCGGCCGTCACTGACCCCACAAAGGTCATCCCACTGACCACACCTTA
CGCCAGGCTTACAGTCGGCACGCCGCGAGAAATCTTTCCTAACGAACATCGTGTCGCATTGACGCCACAGAATGTCTCCA
TGCTTATCAAGAAAGGCTTTGGCACCGTGCTCATTGAGCGTGGTGCTGGTGCCGACGCCGGTTTTCTCGACTCTGCCTAC
GAAAAGGCCGGTGCTACGCTGGTCAATGACGCTGCTGGTGTTTGGCAGGGCGCTGATATTGTGCTCAAGGTTCGCGGACC
AAGTCTCGCAGAGGCTGCTGATGCCCGGCCTGGCCAAACCTTGATATCCTTCGTACAGCCTGTCCAGAACACGGAAATTG
TGGAAGCCTTGGCTGCTCGCAATGTCACCACCTTTGCTATGGATATGATACCTCGCATCTCAAGGGCGCAGTCATTCGAT
GCCCTCAGCTCTATGGCCAATATTGCCGGGTACAAGGCTGTTTTGGAGGCTTCAAACCACTTTGGCCGCTTTCTCACTGG
TCAGGTTACGGCTGCAGGCAAGATCCCACCTAGCAAGGTCCTGGTCATTGGAGCTGGTGTTGCCGGCCTGAGTGCCATTG
TCACGGCTCGCCGCATGGGTGCCATCGTTCGTGGCTTTGATACCCGGTCTGCCACTCGCGAGCAGGTACAATCTCTCGGC
GCAGAGTTCATCGAGGTCGAAGGGATCGAAGAGGATGGCTCTGGAGCTGGTGGCTACGCAAAAGAGGTGTCCAAGGCCTT
CCACGATGCCGAGATGAAATTGTTTTCCGAACAAGCCAAGGATGTTGACATCATAATCACCACTGCCCTGATTCCTGGAA
TGCCCGCCCCCAAGTTGTTGCCTACGCATATCGTCGACATGATGAAGCCCGGGTCCGTCATCGTGGATTTGGCTGCTGAG
GCCGGCGGCAATTGCGAGAAGACCATTCCAGGAAAGCTCTCGGTATACAACGGCACCACCATCATTGGCTATTCAGATAT
GCCTTCACGTCTGCCCACGCAGTCATCAACGCTTTACTCGAACAATATCACCAAGTTTATGCTGTCAATGGCCCCTGTCG
AGAAGGAGTTCGGTATTGATCTGACCGATGAGGTCGTCCGTGGTGCCATTGTCACCCAGAACGGCAAGATCCTGCCGCCT
GCGCCACGACCAGCACCCCCTCCAGCACCACCCGCACCGAAAGAAACTGTACTTGCTGCCGAGTCCGTTGCTCTGACCCC
CTTCCAGAGGACTTCACGTGAGGTTGCTCTTGTGACCGGCGGAATGGGCACAGCAATTGCCCTCGGAAAGCTGACAGGCC
CCATCTTCATGAGCAACGCGTTCATATTTGGGCTGGCCTCATTGGTCGGATATCGCGTTGTTTTGGGCGTTACACCTGCT
CTGCACTCACCCTTGATGAGTGTGACCAATGCCATATCCGGCATGGTAGGCGTCGGAGGCTTTTTCATTCTAGGCGGCGG
ATATCTTCCCGAGACAATTCCTCAAGCATTTGGCGCGCTCTCAGTTCTTCTGGCCTTTGTGAACGTCTCTGGAGGCTTTG
TTCTCACAAAGCGAATGCTTGACATGTTCAAGCGGCCTACGGATCCGCCAGAGTACCCTTGGCTCTACGCCATCCCGGCA
GCTGTCTGCGGCGGTGGGTTTATTGCGGCTGCTTCCACTGGTGCTGCCGGCCTCGTACAGGCTGGCTACCTTGTCAGCTC
CATCCTCTGCATCAGCTCCATCTCCAGCCTTGCATCACAGGCAACAGCCCGTATGGGCAACATCTTGGGCATTCTCGGTG
TCAGCTCCGGAGTTCTGGCCTCATTGCTCGCTGTGGGATTCTCGCCTGAAGTTCTGGCACAGTTTGGAGGACTTGCCACC
ATCGGCAGTATCATCGGCCTGCTAATTGGCAAGCGTATCACACCAACAGACCTGCCGCAGACTGTGGCTGCCCTGCACTC
CGTTGTTGGTCTCGCTGCCGTCCTGACAAGCATAGGCAGTGTCATGACTGACATCTCCGATATCACCACGCTTCACCTAG
TCACCGGATACCTGGGTGTGCTGATTGGCGGCATCACCTTTACCGGCTCTATCGTTGCCTTTCTCAAGCTGGCTGGAAAA
ATGTCTTCAAAGCCGTTAAATCTTCTGGGGCGCCACATCATCAATTCCAGTCTTCTGGCTACAAATGCGGCAACAATGGG
CGCCTTTCTTACTATGGCACCAGGCTCTCCTGCTATAGCGGCGGGTGCACTGGCTGCAAACACAGTCTTGTCCTTCCTGA
AGGGGTATACCACGACGGCCGCCATTGGCGGCGCTGATATGCCCGTCGTCATTACTGTGCTGAATGCCTACAGCGGCTTC
GCCCTTGTGGCGGAAGGCTTCATGTTGGACAACTCGCTGCTGACATCGGTTGGAGCGCTGATTGGCGTGTCCGGCTCCAT
TCTGTCGTACGTCATGTGTGTGGCCATGAACCGGTCACTGGTCAACGTACTCTTTGGCGGCCTTCAAAACATCGCGGCAC
CGGCTGAGGGCACTAAGGCGATAGAAGGCTCTGTGACGAATACAACGGTGGAGGAGACTGCAGAATCGCTTGTCAATTCC
GAGTCTGTCATTATTGTTGTCGGGTACGGAATGGCGGTGGCGAAAGCTCAATACGCCATCTCGGAGATCACGCAGATGCT
GCGCTCTAAGGGGATACAAGTCCGGTTTGCCATCCATCCTGTGGCTGGACGTATGCCTGGGCAGTGCAACGTGCTTCTGG
CCGAGGCGTCTGTGCCGTACGATATCGTGTTGGAGATGGACGAGATCAACGATGACTTTTCGGACACCGATCTGACGCTG
GTCATCGGGGCCAACGACACGGTCAACCCGGCTGCCCTCGAGCCAGGCAGTGCCATTGCTGGCATGCCTGTGCTTCACGC
ATGGAAGAGCAAGCAAGTGATTGTCATGAAGCGGAGCTTGGCTAGTGGCTACGGTAAGCTGATCATACTCTGGACGACGA
AGTTTGTGCTGACTGTCGGCTAGCTGACGTACCCAATCCCATGTTCTACATGCCTGGAACACGGATGCTCTTTGGTGATG
CCAAGACGAGCTGTGACGGTAAGAACAGGCATCCCCGTTTCATTACCAGAGAATCAGAGATAAGCTGACATGTCTCTGCG
TGCAGCTATAAAATCGGCTATCGAGGCGCGAATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62