GenePrediction:GLEAN_775 Details

Name: GLEAN_775
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2022867..2023371 (+ strand)
Length: 505
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2022867..2022986 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_97:2023231..2023371 (+ strand)
Length: 141
>GLEAN_775 class=GenePrediction position=GCSC_97:2022867..2023371 (+ strand)
ATGGGCGCTGCTGTCAACCTGACCGGCACCGTCCAAGAAGTTGTCTCACAGCTAATCAATCTCGACCCTGCCTACGAATC
CTACTTCAATGAGACCAAGGAGTTCTTTGGCCCGCTGTATGTAAGGGGCCGAGACGATTTAGCTGCCTCTGCCGTTCTCG
GTAAGCGCAGTGCTCGATTTCAGGCTTTTCCCATCCGCTTCTTCTAACTGTCCTTTGATCTCTTAGCGCCGAAATCATTG
GCATCGATGTTAATGCACTGCTTCTCCGCTGACGACTTGTTCAGCAATTGCGCCGCCTATGCTCCCGAGACCGGGTCGAT
TCTAACACGTACAAGATCACTAAGTGCCAAGCTGCGCTCCGCAGGGCCCACTATTCTTTCCGTGGCCCTCCGCTAGCGGT
CTGTCTCGCGATAGTGAAGCTCGTATTGAAAGCAGCGAAATCGTTGTCGACAGCAGCCTACGCGTCAGCGTCCACAACTA
CGGCGCTGGCGGCACCGGCTATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62