GenePrediction:GLEAN_7761 Details

Name: GLEAN_7761
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:83777..82720 (- strand)
Length: 1058
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:83777..83096 (- strand)
Length: 682
Type: CDS
Source: GLEAN
Position: GCSC_140:83027..82720 (- strand)
Length: 308
>GLEAN_7761 class=GenePrediction position=GCSC_140:83777..82720 (- strand)
ATGGGCACAGCACAGACCGCGGCGGCTGGTTCCTCAGCTCTACAGGAGAAGCAGGCCGACGGGCCTCGCAAGACGCCCTT
TGAGCTTCCGGAGGCTGGCTGTAAGCCGGCGGCCCGCCCGACCCTGACGGACGCACAGAAGACAAAGTACGACTGGCTCC
TGGAGCAGGCAAAGAGCTGGACCGAGGTTGCGTCCGAGAAGGACAAGGGAGGTCCCATCACAGAGGCCGAGCAGTTGTGG
CTGTCCCGAGAGTGCCTGCTGCGCTTTCTGCGCGCAACCAAATGGAACGAGAAGGAGGCGGCCAAGCGGCTGCAGGAAAC
GCTCAGCTGGCGGCGCGACTACGGCGTCGAGTCGCTGACGGCAGACTACATCTCGCCCGAGAACGAGACGGGCAAGCAGC
TCATCTTGGGCTTTGACAAGGAAACCCGAGTGTGTCAGTATCTGAACCCGGGCCGGCAGAACACGGAAGTGTCCCCCCGC
CAGGTGGAGCACCTCGTCTACATGCTCGAGCGCGTCATCGACCTGTTGCCGCCCGGACAGGAGACTCTGTCTCTGCTCAT
CAACTTCAAGCAGGGCAAGAGCCGCACCAACACGGCGCCGGGCATCGGCCAGGGCCGTGAAGTGCTGCACATCCTGCAGA
CATACTACCCCGAGCGCCTTGGCCGGGCGCTCATCGTCAACGGTGCGTTCTCTGGGTTGCACGCTGGCCCCAATTGAGAC
CGAGTCAGAGACTAACGGCTTTTTGTATAGTGCCCTGGGTTGTGTGGGGTTTCTTCAAGCTGATCACACCGTTTATCGAC
CCGTTGACGCGCGAGAAGCTCAAGTTCAACGAGGACATGAACCAGTATGTCCCTTCGGACCAGCTGTGGTCGGACTTTGG
CGGCAAATTACAATTCGAATACGACCATGCGGCGTACTGGCCAGCATTGACAAAGCTCACCGAGGAACGGCGCGAGGCAC
GCAAGGCGCGGTGGATAGCCGGCGGATCACGAGTTGGTGAATTCGAAGACTACCTCAACGGCGCCTCTGAGACGGGCGTG
GCGTCTACTGAGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62