GenePrediction:GLEAN_7762 Details

Name: GLEAN_7762
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:82256..81467 (- strand)
Length: 790
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:82256..81973 (- strand)
Length: 284
Type: CDS
Source: GLEAN
Position: GCSC_140:81917..81467 (- strand)
Length: 451
>GLEAN_7762 class=GenePrediction position=GCSC_140:82256..81467 (- strand)
ATGAGCGGCGTGGGCAAAGCGACGGGGCCTTCGCGGGACTTGACACCGCAACAACAACAGCATGGGCACGACGCCGCACA
ACAACACCAGGGCCCGCAGCAGATGGTGCATGGCCATGGACAGAATGGCCTTCGTTACCCGACCAGTGGCAAGACCATAT
ACCACCGCCCGCTGAACCGAACGCGCACAGCCGAGCTGAGCCAGTCCAGCTTTGCCTACCTCTTCTCGGAAATGGTCAGC
TATGCGCAGCACCGGGTCACCGGCATCCAGGATTTGGAGAAGCGGTAAGATCTGTCCCGGGAGAACCTCCTGGTGTTCTG
GTCCCGTCTAACTGGCCAGGCTCAATGTACAGGGTCACCCTATCGGTATGAAGCTGCTCGACCTCCTGCTCTATCGCGAA
CCTGCACGCACCCAGACACGCCCTCTGAACATCATTGCGCTTCTACACTTTGTCAAGATCAACGTGTGGACACACCTATT
TGGCCGTCAGGCCAACGGACTGGAGAAGAGCAGCAACCCGGACACGCCCGACGAATATATGATCATCGACAACGAGCCGC
TCGTCAACCAGTACATCAGCGTGCCACGCGAAATGAGCCAGCTCAACTGCGCCGCCTTTGTGGCAGGTATTGTGGAGGGA
GTCTGTGACGGAGCCGCCTTTCCAGCACGCGTAACCGCTCACACCGTCGGCCGGGCTGAGGAGGGTGAGATGTGGCCTGG
CAAAACGGTGTTCCTCGTCAAGTTCGAAGCATCCGTGCTAGACCGGGAGACCTACTTGGGAAAGTCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62