GenePrediction:GLEAN_7765 Details

Name: GLEAN_7765
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:72849..71453 (- strand)
Length: 1397
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:72849..72051 (- strand)
Length: 799
Type: CDS
Source: GLEAN
Position: GCSC_140:71874..71453 (- strand)
Length: 422
>GLEAN_7765 class=GenePrediction position=GCSC_140:72849..71453 (- strand)
ATGCGTTCTCGCCTGCTCCTCAGCCGCGAGGACTGCTCCTCCGGCACCCAATATTACACCTGTGCTTCCAACGGTTTCTC
CGGCTGCTGCTCTGTCGATGCGTGTGACTATTCCGACGGCTGTCCTGACAGCTCCGCGACCGAGTCGTCAGGCATATCGT
CGTCTACCGTCACAACCATTGTCACGACTCCGACCACTTCGAGCCAGACGCCCGTTACTCCATCGCCTTCTAGCACCGCT
GCTCAAAACTTGCCGTCGATCTCGTCGTCCGCTTCTGATCCATATTCCACCCCCCTAACGCGCAGTGCGGCCAGCAAGAC
CAGCCATATTGCCACCAGCACAACCGGCCATACTGCCTCCAGCACGCCCTCTACCGGAGTTGGAAGCGGCAGCACCCCGT
CTCCTGCTGCTATCAGCAAGGGTGCCGTCGCCGGAATTATCACGGCAGGCGTTCTCGCCTTTGTTCTTTTGGCCGCCTTT
CTGATCTGGCGACACTGCTGGCGACGGCCAACGAGACAGCAGACACAGCAGACACAGCAGCCAGAGAAGCCCGAGCAGCG
AGCAGCCGGCGTTCTTGAAAAGGGGCCTGACAATGGCGGAACCGGCAGTGTTGCCTCGCCCCAAACGACCAGCCCCGTGG
ACGGCAGCACTGCCTCGCTGTTCGGCGAGGTTTCTGCTATCCCAGGAACCCTCGAGGCCGTCCTGGCACGCTGGGGCCTC
CACGGCGCCCGGCTCACGGCCCTGCGGCATAAGCGGTTGACGGGATCTCTGCGCAGCCGCAACGACATTGCTGATCTGGG
TGAGTGTTTGGTTGTGTTTCTGTCTGATTTGGCTGTGATTTGGACTGAAGTTGGGCCGCTCCTTCGTTCCTTCTGTTTTG
GGCTTGAGTCCCCCTCGCATCCTTAATCCGTCTCTCTCACTTTGTCCTATTCCGTGCTTCAGCTGTCGGTCTTCAACCCT
CACTGATATCAATAGGGAGCTATCTCGGCCCTGTGGCTGGAACGCCTGCCCGCCTGGCCGAGCTCGACGCCCAAGGCCCT
GCAGTCTTGGCCGAGCTCGAGTCTCAGACGACGAACTACTCGCCCCTTCTTCCTCAGCACTCGCCAGCAATGTCTTCCAG
CACTGGTAGAAGAACCACGGCCGCTACTTTTGTTTCGTCGTGGCGCAGCAGTAGCACCGGCAGCGCTGCCGGCATGCTGG
GTCCGGACGTCGTGACGCCCGAGCTCGACAGCACACCACGTATGGAGATCATGTCAGTGCCACTGGCCGACACCAAGAAC
CAGGGACTCCCTTTTCAAGCGCCGACCACAGACTGGCCGCGTGCGACACTGGATGTAACCCACAAGGAGCAGACTCACGG
GTTGCACGTAGGCAGCTGGGCGTCTTACCGACCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62