GenePrediction:GLEAN_7766 Details

Name: GLEAN_7766
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:70369..69343 (- strand)
Length: 1027
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:70369..70337 (- strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_140:70268..70205 (- strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_140:70051..69979 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_140:69926..69801 (- strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_140:69724..69343 (- strand)
Length: 382
>GLEAN_7766 class=GenePrediction position=GCSC_140:70369..69343 (- strand)
ATGGTCAGGCAGGCTGTCGAGGGTGGTGTCGCGGTGTGAAGTGGTGGTGAATCGTAAGGCTAGGCCGAAGCGGTTCAAGA
TGACCAAGATGACAATAATAGGGAGCAGGGGAAAGGAGCGGAAAAATGTGCGGCGTCCGGCAACAGGCCTTGGTGGAATC
TGCTAGTGGGTGCACACGCTAAACGAGCCACCCGCTGGTGCCTGCTTATAGCGTCCGCATCCGGTTTCCACAACCCATTC
TGTCCAAAAACGAAGACCGATTGACCGGGTGCCCGATTGACCGACCGAACGACCGACCGACCCTCCTTGCGACCGCAGAT
TCGCATGCGCCTCGTATACTGAACGGCCCTGCCCGGGACGATGCAATCGTCGCCGCAAGACAGCACACAATGTAGGCGTC
CCCAGCGACATGCCGCCCGATGTTTCCTGCTGACACTCTGCAGGACGATCTTTGCCCTCACCGTCATCAACAAGGCCGGC
GGCCTGGTGTACAACCGAACTTTTCACGAGGGCGGCCTGAACCAGCTGAGCACCAACGACTACCTCATCATCGCTGGCAC
TTTCCACGGGTGCGTCTCGGCCCCTCGGTCCTGCCGTCGTCTGTCGCCTGTCGCTGACTGTTCTGACGTTTTGACGTTCT
GCTAGTGTCCATGCCATCACCACGCGCCTCAACCCTCTGAAGCACCTCCGCGGCGCTGCCGGGGGTCCTGCTGCCGGTGG
AGCCCCTCCCGGATCTGTCATGACTCCGACCGGCCTTGCGCCCAGCCGTCCCGACCCTCCTTCCGGCCTCGAGGTGCTCG
AGTCTGAGAATTTCCGCATGCAATGCTTCACCACTCTGACCGGGACCAAATTCCTGCTCTTTACCGACACCGCTCAGATT
TCTGCTGACGCGACCATCCGCCGGATCTACGACCTGTATGCCGACTACGTCATGAAGAACCCGTTCTACCAGCTTGAGAT
GCCCATTCGCTGCGAGATCTTTGACCGCAAGCTCAACTCGTACATCCGCGAGACCAACAACCGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62