GenePrediction:GLEAN_7767 Details

Name: GLEAN_7767
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:67730..66482 (- strand)
Length: 1249
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:67730..67541 (- strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_140:67487..67178 (- strand)
Length: 310
Type: CDS
Source: GLEAN
Position: GCSC_140:67127..66482 (- strand)
Length: 646
>GLEAN_7767 class=GenePrediction position=GCSC_140:67730..66482 (- strand)
ATGCCGCCCCGAGGCCGAAAGAGAAAGTCGGACCAGTCCATCGCGTCCGAGACGCAACACACACCCGACCTTGTCGGCCA
GAAAATCGCTACGAAAACGGACAGTCCGGCAGTGAGCCCGAGCAAACGACGCAGGACTGGAATCACCGTTTCCCAGAAGC
AGGCGCTCATTGACAACCTGCAGCTAGAAGGTCGCTCCTCCTGCCGCCCGGTCTCTCCGTCTTCTGCTTGCTGACAGCCG
CAGTCACCGAACGTGCCCGAAAACTGCGGGCCCAATATAATCTCCAGGCCCAGGGACTGCGAACTCGCATCGAAATCCGC
GTCAATCGCATTCCCATGGCCCTCCGCAAGCTCAAGGTGGGCGACCTCCTTCTGAAGCACTCGGCTGGGCAGTCTAAGCC
GCTGGCGCCCAAGCAGCTGGTCGCCTCCATGGCAGACCGCGTGCCGCCATCTGCGCTAGAGAAGGACTACCACGCAGCAC
GGCCTGCCAACCGGGTGCAGCCGTCGCCCTGGACAGCGTATGCTGCACCAGGCCGGCCTCCGAAGAGGCTCAGGTGTGTT
TCATCCCCTTGCGTGCACCTTCCTGCAAACTGACATGGTCCAGCGACAATCTGGTTAGTGGCGACAAGGAGAACCGGAAT
GCCCATTTTGACGGCGCCAAAAAGTGGCCACGAACCAACCATCACCAGCAGGGCGCTGCAGCAGGAGCACCGCCCCAGGT
GCTGTCGCCAGCCTCGTCCAATTCCCGGATCAATCCGCGCGATCGTGAACTCGGAGCAGTTGCCCCGTCGTCGCCCATCA
AGTCGTATATTGCCCGGCCTGTCTCTCCAGAGAAGCAGGCCGCAGCCACGACTCTGCTGAGCTCCATGGTAGAGAAGGCA
CGCTCGAACCGGGTCGCATCCGACTCACGCAAACCTGCCGCAGCATCGTCATCGGTGAACAGCACAACGTCCGCGCGGAT
TGTTCGCAGAGCTAGTGGCACCAGCGAGTCCAGCGACGCCAGCACATCGACCGTAGTGCGCAAGGCGGGCAAAGGTCGGG
CTGTAGGGACCACAGCAGCGGCTACGGTGAGGAAGGTCCCAAGCACAACATCAGTAGCCACGGCAGCACTGTCGACCAAG
AAATCAGTCATGGGCTCCATCCGGAAAGGCGTTGCCAGCGCAGCGTCCAAGAGGGGCGCGGCCAGCAAGGCTGCAGCAGC
AGCAGCAACAACGACGCGGTCAGGGAGGATCTTGCGAAAGCGAGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62