GenePrediction:GLEAN_7769 Details

Name: GLEAN_7769
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:54391..50855 (- strand)
Length: 3537
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:54391..53975 (- strand)
Length: 417
Type: CDS
Source: GLEAN
Position: GCSC_140:53892..51682 (- strand)
Length: 2211
Type: CDS
Source: GLEAN
Position: GCSC_140:51598..50855 (- strand)
Length: 744
>GLEAN_7769 class=GenePrediction position=GCSC_140:54391..50855 (- strand)
ATGTACTGGCCGGTTGCCACCCCGCGCATCTACGCAACCAGCAGCAGTCGCCAGGTAACGATTACCGTCCATGCCGTCAG
CCACGACGGCCTCGACCTGCCATCTCCCTCAGCCTCCAGCCAACGGCTGTCGCCCGGTCATGGCTCTTTCAGTCCGGCGC
TCGGCTCGACCGGGCCGTCTGGTCACGACGCTCTCGGCCTGCCTGTGGAGCCCATGACCCCGGCCACACCGATGACCCCG
GCGATCCAGTCTGTCGAGCATGCTTTCCACCATGACGGCCACGACGGCCTGTCACCACGACCGGCACCGCCTCTTTCTGT
GCTGGGAAAGGAGCCTATCTTGGCCCTGCAGCTGTCTCGGTCAGGCCATCTCTTTGCCACAATCACAGCCACCTCGATGA
CGATATGGCAGACCAAGGTGTGCATGTTATAAATGGAGCCACTGACTGTCGAGCGGCCACGAGGCCAATGCTGACCTTGT
CCTCTTTTTTTTCCTGTAGCCGACCGTTGTTCTGGCCGTTGTCGTGCGATCCAACGTCTCGCTCGCGTCCTACGGCGACA
ATGTCGACCTGCTGCTCCGGCCCGACTCGGCTATTATTGTGGTGTACACAAGCCGAGGCTTCCTGATCACCTACTCGCTG
GCCACAGATGCGGTTTCCCAGGTGTACAAGCCGCAGTTCAGCAGCCACACGAATGTGCAGCGTCGTCGACAGAGCCACGT
CGGCGACCCGGGCCACGCGCGCCCCGACCAGATTCTGTGGGGTCCCGGGGAGGGCGGCGGCGTGCACGATATCAGCGTGC
GCTTCCGCATGGTCATCAAGGTGGATGCCGGGATCGAGAGCGCACTGGCACTGGACGACGAGCTGGTCGTGGCCACAACC
AAACCGGCGGCCGTGCAGTGCATCCGTTGGACGCCGGACAACACAGGCAGCCAGACGAGCACGGAGCTCCTCAGCCGCAT
GGGCTGGTTGGACAAGAAGGTCACTGTCTGTGAGATGACCCACGACAAGCCCATGAGCCTATCAACCTGGGTCACAAGCG
ACGGCAAGGCTTATGCCGTGCAGCGGAATACCGGCAGCCCGTCCGGTTCGCGTCCGGAGTCCAGCCCTGCTTCTTCCTCT
GCCTCGATCTCATCTACCTCCTCCCAGAAGAAGCTTTTCCGAGGCTACTGCTTTCACACACCACAAACGGCCCAAGAGAA
TGCCCGGCGTGCGGCTATTAATGCGCGCTTCTCGCTCGTGGCCGTTGGCTGCGTCGACGGCCACGTCCGCGTATACTCGG
CACGTGACTACGTGGGCAACATCCCGCCATCACATACGCACCAGCCACCCGTATCGGCGTCGACCACTGGCCGCCTCACG
AAGCTGACCTACTCGCCCGACGGCCACTGCCTCTTTGCCGGCTACGAGAACGGCTGGGCCACCTGGAGCGTCTACGGCAA
GCTGCTGGGCCACAGCTTCCAGGCCGAGCGCGACTTGGCCAGGGCCAACGGTGAGGAGTGGCTGGTGGGCGTGCAGGACG
CCGCCTGGGTGGGCGGCTCAGGCGAGATGCTGTTGCTGGGACGGCAGCACGAGGCCGTGTGGCTGCTGGAGATGGCGCGC
AGCGCAGCCGCTGGCTGCTATGGTCCTGCGAACGTGTTTCGCACTGTATTGCTGACTAACCAGAATATCATGGTCTACCG
CGGCTACGACCAGCCCGACATGACGGCAATCTCGGCGGCGCCGTCCCTGTGGCACACCGCGCGCATCCCGTCGACATACC
TGCTGCAGCAGTGGCCGATCCGGCAGGCCGTCGTGTCGGCCGACGGCCGCTACGTGGCGGTGGCAGGACGCCGCGGGCTG
GCGCACTACAGCGTGGCCAGCGGCCGGTGGCGGGCGTTCGCGAGTGACGCCGGTGAGAACGAGTTTCAGGTGCGCGGCGG
CATGTGCTGGTACCAGAACGTGCTGGTGGTCGCAGTGGAGGCGAGCCGGGGGGTGTACGAGCTGCGGCTGTATGCGCGCG
AGTCTGCCCTAGACAGCGGCGCTTTTCACGTGGAGCCGATGCCGGCAGCCGTCGTGCTGGTGACTCCGTCGGGCGAGGAC
TCTCTGCTAGTGTACACGCACGACAACCTGCTGCACCACTTTATCTTTGCCAGCGGTGGCGGTGGCGGCAGCACCAGCGG
CATCCGGCTGGTGCAGGTCGGCCAGATCGGCTTCCACGGCATCGTGCGCAGTCCTGCACGAGTGCGCGGCCTGAGCTGGG
TGCTGCCGGACAGTCAACTGCTGGACGGTGACCCGTCACAGGACGTGGCCGTGGCATCCGTGTTGGTGCTGGTGGACGGC
AAGCTGGTGCTGTTTCGACCGTCCATCAACGACGAGGGCCAGCTCAAGTACGACATGCGCATCCTGGCCCAGAGCGTCGA
GTACTATGTGTGCATGAAGGATCAGCCGTCCATGGAGGACGGTGCTGGTGCTGGTGCCGGCGATGAGGACGCTGCTTTTA
TGCGCAAATCGCTGTGGCTCTGTGACGGTGGCGAGCTCAAGGTCTGGCCGGACACGCAGGTCGTTCTAGATGCAGTGGTG
TCCGGAGGCGAAATTCCGCCGCCTGTCACCATCGCCGTCGACTTCTATCCGCTGTCGGTACTGCTGTCTAAAGGCCTTGT
GCTGGGCGTCGAGCCCGATCTGGTGCAGCGTCGAGACGTCGGCTTTTCATATTTCCGATTCGCCATCAGAGTACGTCTTT
CTCCATCTTCTTTCGTCCCTTTTTTCTTCCTTCCAGGAAGATCCAGGAAGAACCTTTTCTCACCTCCGTGCAGACCAACC
TTTTCCTGCCCGATGTTCTCCGCTCCTACCTAGCCGGCAACCGTGGCTCGGCAGCCCTGCAGCTCGCCCGACGGTACCAG
CATCTAGTGTACTTTGCACATGCGCTTGAGATTCTGCTGCACCAGGTGCTGGACGAAGAAGTTGACGCCGCCCCGCCGCC
CGCACCAGACGCCGCCGTACTGCCGCGGGTGCTGTCGCTGCTGTCGAGCTTCCGCGCCTACCTAGACATTGTGGTGCAGT
GCACCCGCAAGACCGAAGTGCGATCGTGGCGCACGTTGTTTGCATACCTGCCGCCACCACAGGAGCTATTCGAGGAATCG
CTGCTGCGCGGCAGCCTGAAGACTGCCGGTGGCTACCTGCTCGTTCTTCACACCTTTGACGAGCTGGCCACGGCCAGCGA
ACAGGGCATCCGCCTCCTGCGTCGTGCCATGCGCGAGGGCGACTGGGAGCTGTGCCGCGAGCTGGCACGTTTCCTAGCCG
CCATGGACGACAGCGGCCAGACGCTGCGGGAGGCCTTGGCACAGGCGCGTCAGGCGGACGGCGAAGAGAGAGGCTCGGGT
TCTGCTGCTGGCGGTGATTACAATGATGGCGGGCCGACAATGCAGCTGGCAATCCCGCACCGTAACGGGGGCCACGCGAG
TCCATCCGAGTCAGATGTGCAGTCGGCTAGCGACGATGGCAATAGCAGTGGCAGCAGCATCATTAGCATCAGCCCGGGGG
CAGCCGACAGTCGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62