GenePrediction:GLEAN_776 Details

Name: GLEAN_776
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2023880..2024729 (+ strand)
Length: 850
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2023880..2024240 (+ strand)
Length: 361
Type: CDS
Source: GLEAN
Position: GCSC_97:2024298..2024370 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_97:2024498..2024729 (+ strand)
Length: 232
>GLEAN_776 class=GenePrediction position=GCSC_97:2023880..2024729 (+ strand)
ATGATAGCAGTGTTTAATGCGTACGAGTCCCGTGTGGCCCAGCTCAAGACCAGCTCAAATCCGTTTGAGGAGGACGTGGC
CTGGGTTGAGAGTGAGCTCGTGCCCCTGAACGAAGCGAGATATCCAAAATTGGACGAGGGTTTCAAGCATAGCGATGTGA
CATACGACGTGCCGGCAGTCTGGGATAGCCGGCTCTTACGACTGGATAATCAACAGGACCGGCTCGAGCGCAGCCTAGAC
AAGATGCGACTGCGCTGGCCCCTGCCACGGAAAGAGGTTCGAGAAACACTGGTTGACATGATCCGAAAGAGCGGCATACG
TGACGTGTATGTGGAAAGCATTGTGGCACGAGGACTGCGCGGTGTGCGCGGCACGCCGGCCGCCGAATTCTCTAAGATGG
CTAATTGATTGTATATAGTTATTAAGCCGTACGTCCGGGTCATGCCGCTAGAGATGCAGCTGGCTGCCAGCGGCCCGGCC
ATGATCACTCGGTCGGTTTACTGAACCTCACCCGACAGTTTTGACCCTACAACTAAAACCTACAGTGGAGTGACCTAACA
CGTGCCATCTTCGAGGTCCAGGACCGTGGCGCTGTTTATCCCTGACAAAGGGCGCCAGCTTAAACGTTGCCATCATCAAG
GCCAGCGAGTTACGCCCGCTAGACCGTAACGGGCTTGAGGATGTCACGCGTAAGAGCGTAGTCAACCTGGCCGCATTACT
CGGCCGCGAGATGCATATTGAGACCGTGCCTGTCGAGGATGTCTGCAATTGCGACGAAATATTTACGTGTACTACCGCTG
GTAGTAAACACGCCCATCTGGGATACGTACTGGAAGCTGCATCAGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62