GenePrediction:GLEAN_7770 Details

Name: GLEAN_7770
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:47502..44719 (- strand)
Length: 2784
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:47502..46818 (- strand)
Length: 685
Type: CDS
Source: GLEAN
Position: GCSC_140:46051..45253 (- strand)
Length: 799
Type: CDS
Source: GLEAN
Position: GCSC_140:45202..44719 (- strand)
Length: 484
>GLEAN_7770 class=GenePrediction position=GCSC_140:47502..44719 (- strand)
ATGGAGCTCTTCCTCGCCTTTCTCGAACCGCACCGCCTACGATACGTGACCAGTGACAACAGCCTCGTACATGATGACTA
CGTGGAGGTGCGGTATGAATTCACCACCACGGAGGGTTCGCATCGCTTCCAGGGCGACCTCCGCGCTCAGGATCTCGTAG
ACCATTTCGACATCGATGTTATCTGGTCAGACCGCGATAATCGCACCGACTCCTTTGGCAGCGTCCGCGGTATCGGCGCC
ATCCAGCGCATGAAGCTGTGGCGAGATCGCTATAGCGCTTGTCACAACTTCACAATGTACGCCAACCGCACAGACCGCCG
ATACCACGATTACTTTGTGTCTGCCTTTGACTCCGAGATCAAAATCCGCGATGATTCCCACCGCCGCCTGCGCCTTAACG
TGCGTGGCCGCCGAGGCAGTGCTCGTGATAGCGGCAGCAGTAACAACAAGGGTGACGGTCATTCCAGCCGTCGCTTCTCC
ATGTCCTCCTTGCGGCATCGCCCACGAGCGTCCACGTCCGGTCGCCACCACTCGTTACACGCCTCCAGCTCACGGAGCTC
ACGGAGCTCGCAATCGCATTCAGAACAAACCTCTGCCGTTTCACCATCCTCATCTGCCTCTTTCTTCTCACCCGGTGACA
CTCTCGCCATTCGGTATCTCGGCATTCAGTTCAGCCGGAACGAGGGTAAGCTCAATTTCTTTCGGCCGGCGTCGTGGTCC
GTCTTTCTAACGTCCACTCGAGATTACTTTAGATTCATGGAGCAGTGGACACATGCCCAAAGCGCAGACGTAGAGTTTTG
CGGAGTGTCTTTCCCAGTCAATTGCTTTGAGCTGCCCTCGCCAGAACTTCATCCCGGCCATAGAGTCGAACTGAACGACC
CACTGTCCTTTATGAGCCTTCCAGTGGTGGAAGAACCGCAATATGGCACAGATGACGATGGAGATGACGTTGAGGTCCCA
TGACAACGCATTCTACCAACCCTTCTATATGGGTTCGTTTCCAATCGCGCATACAGCCGTAAAGGTGACGCACACATGGC
AATATCAGTCGGAAATAAGAGCATCATTGATAGGTCGCATCTTATCTTAGCACGCATCAGGTCGTACATACTTACGTACT
CCGTACAAGTGTAAGAGACTTACTCAGCCCTTGCATGTGCCCGCATGAGTGTACGTCAGCCCACATCGATCAAAGTGCAT
GATATTAGCCAGACACGATCCTTCTTATCAATTCGGCCTAGACCAATTGTGCCAGTGATGCAGCATCGCCACAATTGGCG
TAAAAGTGTGATAGATTTCGACCCAGAACAACTACCAGAGATTGAAGAGGTGGGATGACCCATGTGATAGTCAACTGAGA
GAAGACCGAGGCAGTGTGTAAAGAGAACAAGCGGCACAGCTCTCCCATTCGGTCTCCGCTCTCGGTGCAAAGCATTCCTG
CATCTACACAGAAGCGACTCTCGCCACAATGAAAGTGGTGCTTTCCGTCAACGCGGGCTCGTCGTCCGTCAAGATCTCTG
TGTATGTGGTTGAGGCCCCTGGAGGCACGCCGCATGAGCTGGCCGAGGCCCAGATCAGCGGACTGACTGCACCGCCGCCG
CGGATTGACTACCGACGTGGCGACAAGGTCGTGCACAAGAATGCGCTTGCCGCCGACGTGGACAGCAGCACGAAGATCAG
CAGCCAGGCAGACGCCTTCAAGCTGCTGCTGAACCTCTTCGTCAACGACAATGCACTCGCCGAGATTGGTCACCGTGGCA
GCATCGCCCTCGTCACCCACCGCATTGTCCACGGCGGCGACTTCTCGGAGCCGCAGATCGTCGGCAAGGGGACGTATGCC
GCGCTGGAGAAGCTCAATGACCTCGCACCTCTGCACAATGCCAAGTCGCTTGAGATCATAAACGCCTGTCTTGACGAGCT
GCCGCATGCCATCAACATGGCCTGCTTCGACTCGCAGTTCCACTCCACCATTCCCCTTCACATTCGCACATACCCCATCG
ACCAGACCATTGCCAAGAAGAACATGCTTCGCAAGTATGGCTTCCACGGGCTCAGCTATTCGTTCATCACGCGTGCTGTC
GCCACCTTCCTCGGCAAGCCGGCCGGCGAGACCAATCTGATTGCCCTGCACCTGGGCAGTGGAGCTTCCGCATGTGCCGT
CCAAGGAGGCCGCAGCTGGGACACGAGCATGGGCCTCACGCCGTTGGCCGGCCTTCCGGGCGCCACGCGCAGTGGCAGTG
TCGATCCAAGGTGTGTCGTGTTTTGCTCAACCGCCCTCCGGATACAGGCTGACTGGCCAGCCTCGTGTTTCACTATGCCT
CAGATGTAGGAAGACTCGCACCAGCGTCAACGAGCCATCTGCATATCACACAGGCAGAGGAGATCCTCAACAAGGAGTCC
GGATGGAAGGCTCTCACGGGCACCACCAATTTTGCCGAGATTGCCGCATCTGATGAGCCCTCTCACAGCCTGGCTTTCAA
TCTCTTCGTTGACCGCGTTTGTGGGTTTGTCGGTTCCTACTATGTCACGCTCGGTGGCAAGGTTGATGCCTTGGTGTTTG
CGGGTGGCATCGGTGAACGCAGCGACCGCCTGCGCGCTGCTGTGGTGAGCCAGTGCAGCTGCCTCGGCTTTTCCGTGGAC
CCAACAGCGAATGTACAACGCGTGACAGGATCTGTCACCGATATCACCAGTAAGGATGCGGCGCACCGAGTGCTCGTGTG
TCAGACAGACGAGCAGCTGGAGATGGCGCGCAGTGGTGCAGAGAGTAAGGCTCTTTGGCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62