GenePrediction:GLEAN_7771 Details

Name: GLEAN_7771
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:42138..39803 (- strand)
Length: 2336
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:42138..42085 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_140:41985..41709 (- strand)
Length: 277
Type: CDS
Source: GLEAN
Position: GCSC_140:41637..41526 (- strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_140:41450..39803 (- strand)
Length: 1648
>GLEAN_7771 class=GenePrediction position=GCSC_140:42138..39803 (- strand)
ATGGAATCCCGCGGCCCCCCTCGCGTAAAGAACAAATCGGCTGCCCCGGTGCAGGTATGTCTGTGATACACGCTGCCGTC
GCTCCGATATCTCGTCCACGATGCGTCCACACTTTTGTTAGCGTACTGACAGTGTTACTTCTTCTCGCTTCAGATATCCG
CAGAGCAGCTTCTTCGAGAAGCTGTAGACCGGCAAGAAGTTCCCCTACAAGCACCTACCACCCGCTTTTCCGATCTAGAA
GAACTGCACGAGTACCAGGGACGAAAACGCCGAGAATATGAAGATTACGTTCGGCGGTCGAGGACGAGCCTGAAACCATG
GGTACAATATGCGCAGTTCGAGCTTGAGCAGAAGGAGTTGGCGCGGGCCCGGTCCGTTTTCGAGCGGGCTTTGGATGTGC
TGCCAAACAGCGTTCCTCTGTGGATCAGATGCAAGTAGTTTCCCGCGTCTTCGTTCTCCGAAAGCAGCTCTATGATGCAA
GTGCTAACACAGCAGGAACAGATGTCGAGGCAGAAATAAAAAACCGAAACATCGCCCATGCCCGAAATCTTCTCGACAGG
GCTGTCACCCGCCTACCGCGGGTGGATAAGCTTTGGTACAAGTATCTTTATGTGTAAGACGAAGCGCCGCCAAGTCTGCC
TTCCTTCGGTTCTGCGTGTTGCTCTGCAATGCTAACCTGTCCACACAGAGAGGAGATGCTCGGGAATGTATCGGGAACGC
GACAAATTTTTGACCGCTGGCTCAAGTGGGAGCCAGCCGAGGAGGTCTGGAATTCGTACATCCGGCTGGAAAAGCGGTAC
ACCGAGTACGAGCGAGCGCGCGATATCTTTCGCTCCTACACCATAGTGCATCCTTACCCGCGCACTTGGATCAAGTGGGC
CAGGTTTGAGGAGGAATTTGGCACCAGCGACTTGGTTCGCGAAGTGTTTCAGACAGCAATCGAATCCCTCGGCGACGAGT
TTGTCGACGAGCGTCTCTTCACCAGCTATGCTCGGTTCGAGGCGAAGCTCAAGGAGTACGACCGCGCACGCGCGATCTAC
AAATTCGGGCTCGACAACCTACCACGGGCGAAGTCCATGCTTCTGCACAAGGAATACACTACATTCGAGAAGCAGTTTGG
CGACCGAGAGGGTGTCGAAGATGTGGTGGTGTCCAAGCGGCGGAGGCAGTACGAGGAGCAGGTGAAGCAGAATCCCAAAA
ACTACGACACGTGGTTCGACTGGGCGCGACTTGAAGAAACCACGGGTGACGCCGATCGCATCCGAGACGTCTACGAGAAG
GCGGTAGCCCAAATTCCCCCGGCCGCTGAAAAGCGGCTCTGGCGGCGATATGTATTTCTGTGGATCTTTTACGCTCTCTG
GGAGGAGACAGAGGCCAAGGACACAGGGCGGGCGAGGCAGATCTACGACACATGTCTTAATCTCATTCCGCACAAGAAGT
TCACCTTTGCCAAGGTGTGGCTGCAGAAAGCGTATTTCGAGGTGCGCCAAGGCGAGATCACGGCGGCGCGCAAAACGCTT
GGCCGGGCAATCGGCATGGCACCTAAAGACAAGCTCTTCAAGAGCTACATCGAGTTGGAAAAGAAGCTGTTTGAGTTCCA
GCGCTGCCGTGTGTTGTATGAAAAGCACATTGTGTACAACCCGGCCAACTGCAGCACGTGGATTCAGTGGGCGGAGCTGG
AGCGCGGCCTGGACGATCTCGATCGGGCCCGAGCGATCTTCGATATGGGAGTCAGTCAGCCAGTGCTGGACATGCCCGAA
GTGCTGTGGAAGGCGTACATTGATTTTGAGGAGGAGGAGGGCGAATATGAGCGGACACGGGAGCTTTATGAGCGGCTGCT
GGAGAAAGCAGACCACCCGAAAGTGTGGATCAGCTATGCACAATTCGAGATCAACATACCGGAAGACGACGACGACGGCG
ACGGCGACAGCGGCGTCAACAGCGGCGACAACGAAGGCGACAATGGCGAGCAGACTGCCGTCAGCAACGACGCGAAGCTG
CGCGCGCGCAAAATCTTTGAGCGAGCACATGCAAGCTTCCGGGACAAGGAGCTCAAGGCAGAACGGGTGGCATTGCTCAA
TGCTTGGCTTGCTTTTGAGAGAACGCACGGCGGCACAGACGATGTGGAGAAGATCCAGAAGCAGATGCCTCGCAAGACCA
AGAAGCGAAGGCGGCTGGAAGACGGCAGCTGGGAAGAATACGTCGACTACGTCTTCCCTGCTGACGACCGCCAGGCAAAG
AGTCAGATGAATCTTCTGGCCATGGCCCAGGCATGGAGAAAGACGGGCGGAATGGTAGCACCGCCAGCAGGACTTGGAGA
AGACGGCTCGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62