GenePrediction:GLEAN_7777 Details

Name: GLEAN_7777
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3083696..3080541 (- strand)
Length: 3156
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3083696..3083691 (- strand)
Length: 6
Type: CDS
Source: GLEAN
Position: GCSC_113:3083577..3080878 (- strand)
Length: 2700
Type: CDS
Source: GLEAN
Position: GCSC_113:3080792..3080541 (- strand)
Length: 252
>GLEAN_7777 class=GenePrediction position=GCSC_113:3083696..3080541 (- strand)
ATGATGGTGCGTTTGCCAAACTCCTCATTACATAGAATCAGTGTTGGTCTTTTGTCGTGTCTGGCACCTAGCTCCGTTTC
TAGCAACACAGTTGCTAATTTCAGCGAGCCTCCTACTAGACCTCGTCTCGGCCCCTCGACAACGGCGAGAGCTTTGCAAG
CCGGCGAGGCCACAGCAACCAGTTATCAATATCAGACCCCAGTCACCATGTCACCGAAGCGATTGGAACACTTTACGACG
ACAGCGACGATGACTCACTTCACGAACCTCGGCGAAACAGTCGCCCACTCAGCTTCATGGCGTCTCCGTACGGCGGAGAA
CAGATCCAGAAGGCCCAGTATACCCGGTTGCAGCCTCAAGTACAGACACCCCACCAGCCTTATGAACGAAATCAACAACG
CATATCTGAAGACACATTACTGTCGACGAAGTCCACAGCGGCCCCGAACAGCGGCTCCTCAGGAAAGCTAGCCCAAACAC
CGCCAGCTCGAGCACCTAGCCAGAAAAGCGCTTTATCCTACGAAGCTTCCCTGACACCCCTGCAACCCCTATCCCCCTTG
TCCCCGACTTTGTCTCTTCGTGATGTTCAAGCAGACACTCACAGCACCTCCCAGTTTCCTATCACAAATATCGATAACCC
GGACGACATCGCACAGGAACTCAGCAATTTACAGGCTCTCCGTCGCATGTCGATAGATGTTGGTAATACTGCTGATCCAG
ACCTCATGCCTTTCCAAGGCCTGTCTCTAATGGCAATGCCATCCATCGCACCTACTGGGGAGGACGATGAAGGCGACATC
TCCAGGTTGCTTTGGGTTCCCGCTAAAGTGCACCCGGAGCTCGCTCCCGACCAATTTAAAAACTTTCTCGAGAATCGGGT
GCAGTCCATGAGGCGGCGATCGGGAGAGTCGTCATTATCTATCGACGCCACACAAATGAACAATACCGGGCTGATGAGGA
AGAGATCGATGCTGTCAAGACAAGTGGACAGTGACGTTGCAAAACCAGGTACCGGCAGAGGTGGACAAGACGACGACGAC
CCTACAAACCCAGCTTCGAGAAGTAGAGGCTCGTCGGCCAGTGTTTCTTTTGGCACACCAGAGTTAAGTTTGAATGAACT
GGTCAAAGATCCGACGAAAGTGGTCCAAAAGCTAGCGATGGACACACAACGTCAAACTGAAGCCAGCCTCGAAAGAAGCG
GCCTCGATGATGACAAACCAATCTTACCCGTTCCATCTATGGGTTTGCGAAGGTCAACTCGGACCACTTATCGGAAAGGT
GGTAGTCTTAGGTCTGGTAATCGGCAACCGCTCTCCAAGCGAGGAGCTGTGCGGCAAACGGAAAAAGATGACGATAAAGA
GGCGGACGGAATAGCATCGGGGTCAACCGAGATACCCATCCCCGGTGTGTTACAGCGTGTCCTGTCAGAACCTATCCATA
CAGAGGGGTCTTCTCGCCCATCGCTCTTTACGAGAAGGAAACTCTCATTTACACAGGAGCATGTGGTAGCAACTGTTCCA
GAAGTAGACTTTTCACCGTCTGAATCGACTTCCACGGATATACCGCTGTCCGCCCTGCTTGACGAAACTACAGCAGACTC
AACTTCTCCAAACACCCTTGGCCCTTCTATATCTGCGGCCGAGTCAGTGTCTCATACCTCTCCCCCCAACCGTCCTCATG
GATCAAGTTCGGCCGAATCATCGCAGCAATCCCCACAGCGATCATCGTCGCAAGCCATTAACATTCCACCTTTATCACAA
CCCTCGACGGCTATACAGAACCAGCAAACAGGCGCCGACGAACAGCAACACCAGCCTCCACCTCGATCAAGCCGGCGACC
ATCTGGCGGGCGCGCTAACTCGCATCAACCTCCCCCAGCAGCAGCTGCAACGGCCGATCTGACAATAGCCTCACCTATAG
CAGCCTCCAAGCTTACTCCAACACCACAGGAAAGTGTCCAGCGCTCAACACCAGCTCCAGCAGCTGCTTCTACTCGGACC
GATAACTTGGCGTCCAGTCCAACTACGCCGGTAGACGAACGGAAACCGGACAAAAGGGCCAAGGACAGGGAGGAAAGCGA
AGGCAGCAAATCCACGGGCTGGAAATGGTTCAAGAATGACGACAGAGACAAAAAGAAGAAGGAAAAAGACGATCTGCTTA
AGAAGGCACGGGCGAAAAGTATCGGAGAGCGTATACAGACAGACAAGTCTCACGACAACGCTCGCCTCGACGTGCTGCAA
AGTTCTATCGACAACGGCAACCACAAAGGACGAGAGAGCGTAGTCCTAGATCGGGATAACGGAGACAACAAATCGCGCGA
CGAAAAGAAGAAAGAGAGCAGCCGGAAATCCAGTGAAGCAAGGAAGGAGAAGGATGGCTTTTCCTTCGGCTCGATATTTG
GTGGATCTCGCCGAAAGGAGAATAGGGAAGGCGGGAGCAGCAAGAGCAAGCAGAGAGCGGCGTCACCCGAGCCTCCGGTG
ATTCTACTTCGTCCGGACGTGGACTACCCCTTCACGCGATTTCCGATTGTGGAGGAGCGTGCCATCTACCGAATGGCACA
CATAAAACTTGCCAACCCGCGACGTGACCTGCGGAGCCAGGTACTGCTATCGAATTTTATGTATTCGTACTTGGCAAAGG
TTCAAGCCATGCACCCGCAGCTAAATGTTCCAGTTTCTCCTCAGCAGAAACGTCAGGAAGAGGAGCGAAAACGCCGGGAA
CAAGAGGAGCAACAACAAAAATACATGGAGCAGCAGATGCAAATCCAGCAGCACCAGTCCCAATCCGGCACCGAAGAATA
CAACCTTGAATATCACGGGGTTAGTAGTCCCCTTCTTTAGCACTCTTGGTGCACACAGTTAGCGAGCATCCTGTAAGCTG
ATATTTTACTTCTCGTCTTTATAGGAAGCAATTCAATATGGAGACTTGAGTCATCACCAAGAGGGCGAACGTGTTGATTA
TGTTGACAATGCTCAAAAGTTTGATCATGCCCAGGGTGACCACCAGAATCATGATTCTTTTGTCGTGGGCGAAGCGTCGA
AGCAGCTCGAGCGAAGCGAAGGCTACGAGAATGAGGGTCAAAATAGTGGAGCACGTGGCTATTATGACTACGGCCACTCT
GATGATAGCCAACATGATGATGGTGGCATGTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62