GenePrediction:GLEAN_7778 Details

Name: GLEAN_7778
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3079417..3076751 (- strand)
Length: 2667
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3079417..3079409 (- strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_113:3078683..3077199 (- strand)
Length: 1485
Type: CDS
Source: GLEAN
Position: GCSC_113:3077086..3076751 (- strand)
Length: 336
>GLEAN_7778 class=GenePrediction position=GCSC_113:3079417..3076751 (- strand)
ATGGCATCGGTGAGCACCCAGCTTATCTCCCTTCCTAGCACAATTTTTTTTCCCCGGCTCTACTGGTGCCAAAACTGGTT
TTCTCACTACTGCCAAGTATTTTGGCTGCTGTGTGATCTGTCAACCTCCATCAAAGCATGATCAAGGCTGCAAGAAAACA
ACGCTGATAGACGACCCGCGATCATAGCAACCTCGTCATTCGTACATTGGCCAAGGTGGTGCTGGGTATTTGCCTAATGG
AGCTGCCGGTGCCCCATCTCCCGCCCTGTCGACCGAAGCCAGACCCCTCTTACCCAACCAAGGTCGAATCGTCCAAACGG
GCCCTATCCGGGTTTTGTGTATTGCAGATGTTCGAGGTAATACAATGGCATAAACCGAAAACACCCCCCCGATTAGTTTG
TCATTTTTTTTTATATCTCGGCATACAATCATCAGCGGAACAGCGTGCGGTTTCTCGAGTATGCGTTTAGAACTGACTAG
AATTGATAGGAAACCTTCGGTCGCTAAACGATCTCGCAAAGCAAGCGCGTGCTGACTATATCATTCATACGGGTGATTTT
GGATTTTATGACGATACATCTTTGGAGCGCATTGCTGAAAAGTACTTACTATTTCTAGCCCCGTGGCACTGATCATCTTT
TATTGCTTGGTCTTTACTGACCGAATGCGCTTCTGTGACCAGGACCCTGAAACATGTGGCTCAATATTCTCCCTTGATTT
CCGAAGCCGTTAAGAAATCAATCTCACAACCCGGCAATGGTGCTTCTGTCAAGTCCCGGTTTTCGCCGAGCGAGCTACCG
CTTTCTGAGCTATCCCTTCTGCTGAACGGTGAGCTCAGATTGAACGTACCAGTCTATACGGTATGGGGTGCATGCGAGGA
TGTCCGTGTCCTGGAGAAGTTCCGGTCTCGCGAGTACAAAGTTCCCAACCTCCATATCATTGACGAAGCCCAGTCCATGC
TGCTAGAAGTCGGTGGCGTGAAGCTTCGACTTCTAGGCTTGGGTGGTGCTGTCGTTATGCACAAGCTATTTGATAACGGT
GAAGGCCGTACCACTATTGCTGGTGGCCAGGGCACCATGTGGACGACACTGCTTCAGATGGGCGAACTGGTGGATACTGC
GAATCGAGTTTACGATCCTACGGAAACTCGCGTTTTCATTACGCATGCTTCGCCAGCCCGTGAAGGCATATTGAACCAGC
TTTCGGTCACTCTCAAAGCAGATTTCTCTATCTCGGCTGGCCTGCACTTTCGGTACGGCAGCTCGTATAATGAGTTTAGC
GTCAATCCCACCCTTGATCACTATCGTGGTAAGCTGGCTGCCAGCAAGGCATCTTTCAATGACGTATGGGAGACTGTCAA
GGGAGAAGTCGAACCAGCCATTCAGCAAAACGAAGCACAGCAAAATTTGCTCAAAAACGCTATTAGCATAGTGGAAAAAA
TGCCAACAACAGCAGCTGGTGGGAATCCTTTTGGCTCTGCAGGAGGCCCTCCTGCTTTAGGCCAAGTGGACGAGAGTGCA
TTCAAGAACATGTGGAACTTTAACCTTGCCGATGCAGCATTTGGCTTTCTAGTTTTGGAAATCCAGGACGGTCGTATCGG
TACGGAGATGAGGGCCCAAGGCTTCAATTTCTCACATCGCGGCATGAAGCAGCAGGGCAACGCACCACAGCAAGTTCCAG
CTCCAGCTGCAGCTTCCACTGCCTCGCCTCAGCCAGTCGTTGCCACCCTCCCTCCTACGCAGCCGCAGCAACAATCCCAG
ACGCAGGCCATCTTGCCACAGAGCCAGTCGGTCATACAACAACAGCAGCAGTCTACGTCAGGCAAAGCTGAACCAGGAAA
GCTGACAGCCTCCAACCCTGGCTCCGGTCCCGCGAAGTCTGCTACGCCTCAACCCCCATCGCTGCCGAGCCGTAAGGACT
TAGATAAGCCTTCCGTCTCAACGAATGGCACGGTGAACGGACCAGAATCAATTCCATCTCCTGCCCCGAGGGGCTCGGCT
CAGGATGTCATCGGCTTGTTCATTATGAATGCCCAGCCTGACGATCAGACCCGGGAGCTCTTCGCTGATGAAGACGTGGC
CAGGATTGTCAAAATCGAGAAATATGGACAAACGAATAAGGTGGTTCATTTCAGGACCGTCGAAGACCGTGATGGTGCAA
TGGCGCGACTGCCCGAAGAAGCAAAGCACCGTGCCACCGAGGACCGTTCCAGACCTTTGGTAAGAAATTTTGTTCCCAGG
GAATCAAGTAAGCCATTCGGACGAGGAGATCGGGGTGGAGCAGGCACTTGGGGGAGCAGTAACCGAGGCGGTGGCAACGT
GAATGCTGCAGGGCAGAGCGGGTATCGAAGTGCTGGGGGTGGGACTGGAACAGCCAGTGACAGCGAAGGTGCTGGCCGGC
GCGGCGGCGGGGGGAATGCAAGGGGCAGCCGAGGGGCCGGTCGTGGAGGTGAGGGTCGAGGACCCCGTGGCCGAGGAGGT
CCAAGAGGCGCTGGCGTTAGCAAAGCAGATGGAAGCAGCGCATCCCCGGCGCCCACGTCTTCTACTCCAGCAGAGTCGTG
AACAATCTGCACTTTATGGTTGGCACGAGCTTTCGGTCAAAAATATGCAGCTTTACTTGGACTCATTTAGGTCCGCTCCC
TGTGGCTGCTTGATGGTGTCAGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62