GenePrediction:GLEAN_7779 Details

Name: GLEAN_7779
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3070993..3065050 (- strand)
Length: 5944
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3070993..3070980 (- strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_113:3070912..3070830 (- strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_113:3070622..3067371 (- strand)
Length: 3252
Type: CDS
Source: GLEAN
Position: GCSC_113:3067194..3067129 (- strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_113:3066941..3065529 (- strand)
Length: 1413
Type: CDS
Source: GLEAN
Position: GCSC_113:3065465..3065316 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_113:3065246..3065050 (- strand)
Length: 197
>GLEAN_7779 class=GenePrediction position=GCSC_113:3070993..3065050 (- strand)
ATGTCAAGTCCGGGGTACAGTCGAACCTGGTTTTTCTTTCTTTTTTTCATACGTGGAGGAGGTGGCTAACAAAACATCTA
GCTCGGCTGCCGGCCCTTCGGACACCTTTGAAGAGGCTGCTCCAGCGCCGCGAAGATCTAGTCGTGGGAAGAAGGCAGCA
GACGGTACGTAATAATTGGGTCAGGAGTCGATATCAACAGGCTGCTGTTAGGTGAAAGGGATCGGACGAAACCATAACAG
TGTGCCGTGTTGCTGTGCTGAAAGGATATATCGAGGCAACTTTCTAACCGCTATTCTAGTTACACCAGCAACCGAATTAA
TAGCACCAGATTTTCCAGAGAATTCCAAACAATCTTCTCATACTCTCGCAGAACAAGACACAGTTATGACGGAATCGGAC
GAGGTTGGAGTGGATCGCATTTATTCACCCCCACCTGATTCCGAACACGAACAAGATGACAGCGAAGATAATGAAGAGGA
CGGCCTCCATCGATATACACAGGACAGTCTTTCAGACTCGTTTGGTGGTGGGTTCTCTATGCCTCCGCGTGGTTCTGGCC
TGCCGGCCGCCTTGAGCATGCTTGGAGGCATGCTCTCTATGTCTGGCATCGGCGGTCGTCTTCGAGAGATTCTGAACAGC
CTTCGTCAAAAGGACGACCCCTCCGTGCAGCTGATAGCACTCCAAGACCTATCGGAAATTCTTCTCGTATCGAACGAGGA
CAACCTATCCGGCAGCTTCTCACCGGATGCGTATGTGAGGGAGCTTGTGAGTCTCATGCAACCAAACGAGATTACGGGAG
AAGAGAATCCAGAGGTAATGCTGCTTGCATGCCGATGCCTAGCAAATCTCATGGAGGCTCTGCCAGCAAGTGTAGCCAAC
GTGGTTTACGGTGGTGCCGTGTCTATTCTTTGTCAAAAGCTGCTGGAGATCTCGTTCATTGATCTTGCCGAGCAGGCTCT
CAGCACACTTGAAAAAATATCTTTTGAGTATCCTGCCAGTATCGTGCGCGAGGGCGGCCTGACGGCATGTTTATCATACC
TCGAGTTTTTCGCCACCAGCACGCAACGAACCGCTGTTACAACTGCTGCAAATTGCTGCCGCAACATACCAGAGGACTCG
TTCCCAGTCGTTCGCGACGTTATGCCCATACTCTTGAACGTCTTGAATAGCAGTGATCAGCGGGTTGTGGAGCAGGCAGC
GCTCTGTGTGTCTCGCATCGTGGAAAGTTTCAAGCACCAACCGTCCAAACTCGAAGAGCTTGTCGGGGTGGATATGTTAA
AGGCTATCCTTCGGCTTCTCCTACCTGGCTCGACAAACTATGTGATGGCACCCAACCTACACACACAGTTTCTACGCGTG
CTCGCAATTGCGGCACATGATAGCCCGCATCTAGCAGCGGAGCTCTTTAAGATGAATGTTGTTGAAACCCTGTACCAAAT
TTTGACAGGCGTTTCTCCGCCGCCCGGCACTGAGGACATCACATCCAAACTGGACAGTGTTTTGATTATGCAGGCTTTGA
TTCACCGACCCAGGGAGCAAATAATCGAGACGCTGAACGTTATTTGCAATCTGTTGCCAAGAGAAGCTACCAACCTCTAT
ACTGGACCATCAAATGATGTCACGGAATTGTCTGGCTCTGCAGATTGCAGGGGTAGCGCGGCCGCTATCGATTACTCAAA
CTCTCGAAAACGATCAATTTTGAACGAGAAGCGGATTGACCTACTCAAGGACTGCAAACTCGAGGTTCGGCGGTTTGCCT
TGATACTTTTCCCAACGTTGACAGACGCTTATTCAAGCACCGTAAACCTGGACGTTCGGTCAAAGGTCCTGTCAGCCCAA
CTGAAGATGCTGTCGAATTTCGATCAAGACATTATCCAAGAGGCTCTCAAAGCGGTCCCATACGCGTCATTCCTAGCATC
TATCCTGTCTCAGCAGGATCACTCTATTCTGGTAAAGTCGGCACTGCAAGCAACTGAACTGCTTCTGGCGCGACTCGACA
ATGTCTACAGATATCAGCTTTATCGAGAGGGTGTCATCAACGAGATTGAGAAGATTGCTAGTATGGTCGAGCCAGAGCCA
CCTCTAGAGCCAGAGCCGGATACACAGGCTGATTCTGAAAACGAGTCTCTAGGAGAGGAGCCTCTTTGTGTAGATGCCAT
CTTGAGGTCTTCAGTAGAAGACCATGTGGACTCTGCCAGCGAACTTGAAAGCGGCGATCGCGATACCAGCAGCAAGAGCA
GATGTCATACGGGAAACAGAGAAGGAGACACCAACATTGATGGGGAGGTGGAAGAGAATGATGGCGACGGCGATGATGCA
GGCAGTTCCCAGCTTTCTTCTGACGACGACGAGGCGGAAGAAGGTGAGGACGGCGAGAACAATGACAATGATATGGAGGA
TCACCATGATGAGGCACCTGGCTCCCCCGCTAGCTCCGATGGCTCAACAACTTCCACCGATTCCCCACCGAGACATTTGG
TGGCCAATGTACCATCTCGGGCCCGTATAGCTCATTTCGCGAAAAGAATTCTGGACACGCACGAGACCGAGAAGAGTGGC
AGAGAAATGCGACAGAAAGCAACTGAAATTCTCTCCGGTCTGTTTGGTTTGGCTCAGGAGATATCGAGTTTCTATCTTGA
ACGAAGCTCTGCCAGCAGGCCCTTGGAAGACGGTATCGTTCTGTTTGAGAGGCTAGCAGGTTTTTTTGACTCGGACGTGT
TCGAAAGTGTCACCAGCGCCGAGCTCCTTGAGTCTGGTCTTGTTCGTGTCCTTGAACTCATATTTAGCAACCCCCAAGAA
GGACTTGCCAATGCTGCAAGATCTGCCTTTCTAGAAGTTTTTATGGGTTACGCCGTAAAATCGCGACCTAAGACAGCAAC
TTCAGACTCCCCAACTACACCTTTCAGTATTTTGGTACACAAGTTGCAAGACCTACTCAGCCGATCCGAGAATTTTGAGG
TCGTTACTGTTCATCATAACACCTTTGACGGGAACCACAGCAGCGCTGCTTCGATGCTCGCCAAACAAATCAGGCTTCGG
TTAGTTGCAGACGACGGCTCTGATATACCTGGGCCATTTCGAAGTATCATGGTATCTATCCATGCTATAGCGACATTTCA
GGCCTTAGAAGACTATCTGAGGCCTAGAATCAACCTTTCTGACCGCTCGCGAAATATCAAAAGTGATGGCTTCTCGAGGG
CACTGGCTGCCATGGCTGGTTCTTCGAGTGGGGGGCTTAGCACTTCTGCTGCTGCACGTCTTTCTGAGCGTAGCGCTCGG
TTACTTCCAGGGGGATCATTGATGTTGCGACACAGTCCCTCTGCCCCATCCGAAGCTCCGGCAAGCACCGCGTCCCGCCA
GCTTTCGCATTCCCGACAGGTGCCACCAGCCGAACTAGAAGACATACATCCAGGTCGCACGGCTAGCAAGCAGAGAGCAT
CAGCAACCATGCGAGCACCCACCATGGCGACGGAGGAGACACAAATTGTGCCAGGTCACGGGTCGGGCTCAAGAGACAAA
CCTGCTACGCACCAATCTTCCCGCCACCTTCCAGCCTTCTCTACCGAATTGGCATTATCAAGTTCACCCGGTGAGGCGGA
CCCACCAGCAGATGCTCTCGATTGTGCAGGCGAGAAACATGTTTCAGATTCGAGTGCAGACAATCTTTTGGGTGAGGACG
TCCTAGGTGCCGTTGTTGGAGAAATTGATGGGGGATCGAACGTCACTGCAACTGCAACTACAGAAGATCCATCTGCCGTC
AATCTAGAATTTGCTTCTGGGGGAAAGATCACAGCACAGGGAGCGGACGGATCTCGGATCTTAACGCCTTCAAGGAGCTC
GCCAAGCGTTTCTGGGAGGACCCGGGTGAGTGCATTAACAACGGCACTGCAGAGCTCACCGGTGGCCAGACCCATATCTG
CCCCCCCTCGTGCTATCTCATATGCGACATCATTGCAAACGAACCCCCAAACCTGGCACATGGAGTTCACACTAAATGGG
AAAGTGGTATCAATGGACAGCACAGTATATCGTGCCGTCTTGCTCTCGGCAGCTAGACACGATGAGCATCTCGGGCGCTC
AATCTGGTCCACAATTCATTTGGTGCATTATCGCCGTGTTCCGGGATCCAAGCAGGCCGAGGTCTTGACATCAAGTCAAA
TGGCCGAACCCATCAATTGCTCTGTTGATCACGAAACGACAGATGCCAGTGCGGCCCGGGGCCCACTGGACAAAAACCCG
ATCGCGTCGTCGATCTTGCGACTTCTCCGAATTCTCCACGATCTGAATGCAAACATCGACGATGTACTGGTGACAAACAA
AGAAGCTTTGAAACTCAACGTCGAACCGCTGTCGCAGTTTGTCAACACGAAGCTGACAGCTAAGCTGAATCGTCAATTGG
AAGAGCCCCTCATTGTTGCCAGTAGCTGTTTGCCGAATTGGAGCGAGGATTTGGCCGGGCTTTATCCCTTTCTATTTCCA
TTTGAAACCCGCCACCTATTTCTGCAATCCACCTCGTTCGGATACGCACGTTCGATGGCACGATGGCAAAACTCGCAAGT
TCAAGATGAGTCTCGCCGAGACCGTCGTGATGACCGCCCTTATCTTGGCCGCTTGCAGCGTCAGAAAGTGCGAATATCTC
GCTCCAAAATCCTCGAGTCGGCCGTGAAGGTTATGGAGCTTTACGGTGCATCGCAAAGCATGTTGGAGGTTGAATATTTC
GAGGAAGTTGGTACAGGGCTGGGGCCCACCTTGGAATTCTATTCGACTGTCTCGAGGGAATTTTCGAAGAAGAAACTCAA
ACTGTGGCGTGACAACGATTTCGGCGATTCTGAATTTGTCACTAGCCCGAACGGGCTGTTTCCGCGACCACTAAGCAACG
AAGGTGGGACTGGCCCAAATGACGAGCGCATCCTGAGCCTATTTCGAGCACTGGGAAAGTTTGTGGCTCGGTCTATGCTC
GACTCTCGCATTATCGACATCAATTTCAATCCGATCTTCTTCCGAATTGGTGACGAATCGACGGGCGTACGCCCATCGTT
AGGGGCTATCAAAGTGGTCGACCCGACGCTGGCTCGTTCCCTCCAGCTCATCAAAAAGTTTGCGATTGCAAAGAGAGAGG
TCGAAGAGGACCCGCATCGTTCTGTCTCCCAGAAGGTGGTCGATATCCAGGCCATTACCGTCGACGGCACCAACATCGAT
GATCTATCCTTGGACTTCACCCTCCCAGGCTACCCGGAGATTGAGCTTGTCACCGGGGGCGCCCATATGAACGTCACGAT
TGAGAACGTCGATGTGTATATAGAACGTGTCGTGGCACTGACTTTGGGAAGCGGTGTACGCCGCCAAGTCGATGCATTTC
GCAACGGGTTTTCCCAAGTGTTCCCTTACTCTACATTGAGTGCCTTCACACCGGATGAGCTGTCATCCCTTTTTGGACGG
ATCGAGGAAGATTGGTCTCTCGAAAGTAAGTCATCCGCAGTGATAGCAACATAGGGCGCTGCTGACCTAGTACTTAACCG
CACACTAGCTCTTGTGGACTCTGTTAAAGCCGACCACGGCTTCAACATGGATAGCAGCAGCGTCAAAAATCTTCTGCAGG
TCATGAGCGAGCTCACTCTGGCAGAGCGGCGTGACTTTCTCCAGTTCACTACGGGCAGTCCAAAACTGCCTATTGGGGGT
AATTTCACTCTTGCTCTTACGTGGAATCCGGACTATCGCGTTTTGCTAACAGTAACTTTCGTTACAGGTTTCCGCAGCTT
GACACCGATGTTTACGGTAGTATGCAAACCGAGCGAACCTCCATTTGTTTCAGATGACTACCTTCCTAGCGTTATGACGT
GTGTCAATTACCTCAAATTGCCTGATTATACCACCGTCGATGTTCTTAGGAAGCGGCTGTTCACCGCCATCAAGGAAGGA
CAGGGCGCTTTTCATCTGTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62