GenePrediction:GLEAN_777 Details

Name: GLEAN_777
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2039162..2042557 (+ strand)
Length: 3396
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2039162..2039866 (+ strand)
Length: 705
Type: CDS
Source: GLEAN
Position: GCSC_97:2039939..2041600 (+ strand)
Length: 1662
Type: CDS
Source: GLEAN
Position: GCSC_97:2041673..2042259 (+ strand)
Length: 587
Type: CDS
Source: GLEAN
Position: GCSC_97:2042440..2042557 (+ strand)
Length: 118
>GLEAN_777 class=GenePrediction position=GCSC_97:2039162..2042557 (+ strand)
ATGTTCTGGAAATTTGGCGGCTACGCCAGCATATCGCCCATTGACTCTATTCTTGATCGACCGCAGTTTGCTCTTGAAGA
TCTGTTGGACGAGAATGATTTGCTGGGCGACATCAAAGCCCGCAATGGCAAACTTCTCGATTATCTCCGGAAGCGCGAGG
TTTTAGAGCGTCTTCTAGAGTTCGTTGTCGCTCCTAAGGCTGAGCCTGCTGCCGTGCCTATTGGCGATGATACGAAGGAC
GACTCCGCTGGCGCTAGCGACGATGCAAGCAATGAACGAGGGCGGCCCCGTCTTTTACCGTTTAACCGTCCACGGGCATC
CTCCTCACTGACTGATGGCGGCCGAGATGATGATGAGGCTGAAACGAAACGTAACCGGTATGCGTATGTCTCTTGCGAGA
TTCTGTCTTGCGATAACTGGTCCATATGTGAGACTGTGATGGATCCCTCAAACCGCGACCTGCTGCACAAGTTTTGGCAG
TATATCAAGCAGCCGGCTTTGCTTGATCCACTACAAGCTAGTTATTTTACCAAGGTCAACGAGTCCCTTTTCGACAAGAA
GGTTGACGATATGGTGGTATTTTTAAAGTCTATGGATGGCGCAGTGCAGGATATGTTGCGACACGTCGACTGCCCCATGA
TCATGGACCTACTACTGAAGATCATAACTCTGGATCGTCCGGAAGGAAGCCCTGGCATTGTTGAGGTACGTAGAAGTGTC
ATTATCGAACAGTTTGCGCCTGAGAAGTGTGACAAATACTGATCTACATCTATTTAGTGGCTTTATACGCAAGACGTGAT
GCCAACTCTTCTCTCCTTTCTTAGTCCTAAGAACAGCTGGGCAACACAAACATCAGCTGGAGACTTCATCAAAGCCATCA
TCACGGTCTCTGCCAACGCCACTCAGAACGAGCAGACATGCATCGGGCCAAACGAGCTCACCCGGCAGCTAGTTTCCCAC
CCATGCATTGACGAACTAATCAATTATATGCTCGGTGGCGGCAATGCATTGACCGTCGGCGTGGGAATTATCATCGAGGT
CATCCGAAAAAACAACTCTGACTATGATCCGGATGTTGGCACCGAAGCCAACTCGATTCCCTCAAGCCGAGACCCCATTT
ATCTCGGCACCTTGCTACGGATGTTTGCGGAGAATGTACCAAACTTTATGCAGTTGATGAACAATGCGCCTGCCCAGAAG
ACTCGCCTCAACTCTACCTTCAATGTCAAGATTGAACCGCTTGGTTTTGACCGATTCAAGACCTGCGAACTGATGGCCGA
ACTTCTCCATTGCAGCAACATGGGCTTGTTGAACGAGTTTGGCTCCGAGACTGTCATTGCTGTTCGCGATGCCGAGCGCA
AGCGTCTGCGGAGTGAAGGCAAATTAGCTCCAAATCGGGGCGAGGATGCGATTGCGCCAGGCACCGATCTTCTTACCATG
CGTGTGCCCCATGCACCCGCTGCCGAAGAGGGGCGTCGCCTCGAAATAATGAATGTGTCAGCCTCTGACGAGGACGGGTT
CGAAGAAGTCACACATACCGCCGACATGGGCGAGAACGAGAAACAGCAATACAACGTTCTCCCCTTAACAGGTCCTAGGC
CATCGACTTCATCTCTCTTTGAGAAAGATGACGATGATTTTGTCGATGAGCCTCTCAGTTCCCCCCGATTGAACACACGG
GACGACAAATTGCCAGAGCTTGAATTGCCGCACTTTGATGAGCCAGACCTTGTTGTAGCACCTCTCTCGCCCACCAAGAA
GAAGGTCTTATCCCAGTTCAGCGACCCAGAGGTGTCAAAAGATTCAGAGTCTTCATCCACTCCGTCGACAGTGGACAATG
AAAGCATCGACGACGCAACTGTCAGCTCCGATGATTTTGTTACGGAAGCGACAGAGCCAGCATTGGGCAAAGGCGCAAAA
ACAATGTCCGATGCAGACAAGGGCGATGAATCCGACGCGGGCATCGTTTTCACTCCTACAATCTCCAGTTTGTCTGAATC
TTTTCACTCGACAGCACAGCGTTCGTCCAGTCCAATATCAGAACTGCGTGAGCAGCTTGCCAAGACCATAATTTCTGAGG
AGGGTATTGTCCTAGAACAGGCAGAAGAGGTTGTCGCGAAAGAGACTTTGCAAGAAGACAACCAAGCCCCGACTGCGCCC
TTGAACGAGCTTATGCCGTATTCCACAGAACCCGCGCATGAAGCCAGCAAAAATGCCGGCGAGAGTAAAGCAAATGCAGT
GTCTACTACCGACGCGACAGAGAAAAGGGCAGCCGAAGAAAACGAACGCGACGCCGGAAATGAATCTATTGTTGTGGCTC
CTCGACCAGTCGAAGCAAGCTCAAAACTCTCGACCGTGAATGCCACTGCGGACGAGCCAGTAGTAGGCGACCTGCTGAAG
ATTCAGTTTGTTGAGCACCGTGTGGTTCCTACCATACTTGTGAGCTATCTTCTCCCTCCATATAGATCCGTGGCTTCCTT
CGTTTTCATTGTGCGTGACTAACATCACAAGTCTTTCTTTTTCTCGTATCCCTGGAACAACTTTCTTCACAATGTCGTGT
ATGACGTGGTCCAGCAAGTTTTCAATGGCCCGATGGATCGCGGGTTCAACCCGAATCTGGCAATTTCTCTTTTTGAGTCT
GCAGACGTGACCACCCAAATAATAAACGGGCAGCTTGCGTCTGAGAAGTCCCAGGTCTCCACAAGAACCCGCATGGGTTA
CATGGGCCACCTAACACTGATCGCGGAGGAAGTCGTCAAATTCACGGAACGTCACCCCCCGGAGCTTCTCTCTGAGGTAG
TGTTGGAAAAGGTCATGTCTCAAGATTGGATCAATTATGTCGAGGGCCCGCTAGCGGAGACACGCGAGAGGGACAATGCA
ATCCTCGGTGGTGTTCGTCCAGATGTGTCTATGGGCAACCAAGCGGGTACTGCCGGATTGGCTGCCGTCGGTCTTAGCGG
GTTGGGCTCGTCGTTTGGGATGGGCAATACCCAAAACACGTCATCAGCATTGGCTGACGCTGGGCTGAACGGAAGCCTCG
ATTTCCAGGGCGAGGCTGACGGAGGCCTCGGACCTTTTTCGATCAGCGCTGGAATATCGTCCGGTTTCCATAGCTCGAGT
GATGAAGACGAAGATGACAACGACGACAATGATGAGGACATCAATGACGAGGTTAGTTGTTCCCTTCCCGGTCCATTTTT
ATATCACTTTGCGGGGGCGCACAAAACAGAGGATGCGACAACACAGGCCAACCGGCGTTCTGCGGTTATTGAAAACAGCA
CTGGCAATTTCGTGCACACTGGTGACGACTGCAAAGATGACGAGGAAGGCCAAGTCAACATTGATGTCGACATTATATTT
GGCGGAGCTTATGGTAGTGACGGAGACGTCAGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62