GenePrediction:GLEAN_7781 Details

Name: GLEAN_7781
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3057367..3055395 (- strand)
Length: 1973
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3057367..3056644 (- strand)
Length: 724
Type: CDS
Source: GLEAN
Position: GCSC_113:3056518..3055682 (- strand)
Length: 837
Type: CDS
Source: GLEAN
Position: GCSC_113:3055550..3055507 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_113:3055418..3055395 (- strand)
Length: 24
>GLEAN_7781 class=GenePrediction position=GCSC_113:3057367..3055395 (- strand)
ATGATGTCTGGACGCAACCTGATCCAGCCCGCGTATTTTGACCAGCCAGCAGAAGCCGTCGGTTCCATTGGCCCAGGCGT
GCTGCCCGCTGCACCGGGAGCCCCGACAGCTGTCCCGATGAGGAAAGGCGCCATGTGTTACGACAACTATGTTCACAGCA
CCCAGAATCCCGGTACAGGAAACTCGCTGCAGCTCGACGCGGGTTCTGCGGCCACTGCTCTGGTCAGCCAGACCTTGTTC
AGCGGCACCGCGGATGTGGGCATCATGCCGGCACAGCAGACAGCAATGGCCTCGGACGAGCCACAACCCATCGTGGCAAG
AACCTCGTCGGGAGACATACGGGGGATCGTTCTCCCCGGCGCCATATATTACCGGCGGGCCGGCTATACCTTCCCACAAC
GGCGGTATGCCATTCTCCTGGACGATCCGATCGCAGAGACCGAGTGTGGTGCCGAAATTTTCGAGCTTGGGACGGCGCAC
GTCTACGGTTATGTTGTCCATATTGGCCGCTACTCTCGTGTCCAGGTTGTGTATGCTGTTGCCGTCGCCGATGGCTTCTG
GGATGTCAGCAGCCGATTCGACGAAGAGACGCGCAACGCTACACTCTGGTACGACAGGCAGCCCCGAGCATTGCCTCTGT
GTCTAGGCACTATCGCAAGGGGCGAGGGGGCGAGGATGGGTCACAGCATGGCGGCTGAGGCTTCTTCACCCGCCTTCATC
ATCCGTGAGTTGTTTCCACGAGCTCTGCAAGGGTGCCTCGAGCACCGGTGCGAGTCCGCCCCCATCTCCCTTCTCCCCCA
TGCCAGGCCGCCAGGTACTAACAGCCGTGGTTCTGGTCCGCGCCATAAGAAACCCCAGTGATGCAAGAACAGTCCAGTTT
TGGCTACGGCAGCAGCAACGAGCCTGGCTTTATAATGCCGGCAGCTTCTTCGGCCACCGGCCCATCGTCAGCAAAGCCTT
CCCTAGGATCTCCCATCCCCACACTAGCTTCGATGGAGGACAGTACGGCAATGGCCCGACCTGGCCACAAGAAGGACTGC
CAAGTTCAGTTCGTCCACTACCGAGGCATCAGCGTAGACGGGGAAAGGCCGGTCGGGCTGCTTGGCAAGCTCGACACGGA
GAGCGATGGGGAGCAGCACTGCCTGCCGCTGCTGAACGACGAAATGGCAGATCAGGATACGTCCATCAACGAGCTTCTGC
CAGACAAGAAATGCCCCTTCCAGACATGCCCATACCATAAGAAGGGCTTTGCGCGGAAGCACGATCTTGTCCGGCACGTC
ATCACACACTACGATGGACAGCTGTACTGTGGTTTCTGTCCAGACGAACTTGCAAAGTCATTTGGCCGGCCCTTTTTGCG
GGTAGAACCACTCAAACGCCATCTGGCAGTTGTTCACCACGCTGCCAAGTTCCGGAAGACGCAGAACACCACCGAGACGT
ATCTGAAGCTCCGCCTAAAAGAGTATGGGGCGGTGCATGGGGGCCACTGCAACATCTGTTCTCGGCAGTTCTCCGTGGCT
GCGAAGCTGTACAACCACATCGAGGGCTGTGTTGTGCGACTGCTTCTGGAGCGCGCGCGAGCAGGTGACATCGAGCCACA
GGAGTCAGAGGAGTTGTCGGGAGCACAGCTTGGCTGGAGCACCAACCACCAGGCCTCGAGGCGGGCGGGTGCAAAGACTG
GGACGGGTACGTGAGGCGTAGACAGCTCACGAACGGCGGCTTTTCTGGTTGATTTGGTTGGGCGGCTTTCTGGGTTATGG
TCTGGTTTTCGACCGGTTTGCGAGGTCTGCGAATATCCTGACGACGAATGGTGACAGAGGGCGATAAGAAGCAGGAAATT
GAGGAGCAAAACATGGTCCCGGTTCGTCAATGCGTACAGTAGTTGGTCAAGCTCTCTGCGATCAGCACATAGGGATGGTC
GAAGCCGCGCTGACTAATCGACGGTGAAGGGCTACGACGACTCTTCGCTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62