GenePrediction:GLEAN_7782 Details

Name: GLEAN_7782
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:3054780..3049801 (- strand)
Length: 4980
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:3054780..3054644 (- strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_113:3054582..3053084 (- strand)
Length: 1499
Type: CDS
Source: GLEAN
Position: GCSC_113:3052384..3052132 (- strand)
Length: 253
Type: CDS
Source: GLEAN
Position: GCSC_113:3052049..3051823 (- strand)
Length: 227
Type: CDS
Source: GLEAN
Position: GCSC_113:3051759..3051090 (- strand)
Length: 670
Type: CDS
Source: GLEAN
Position: GCSC_113:3051031..3049801 (- strand)
Length: 1231
>GLEAN_7782 class=GenePrediction position=GCSC_113:3054780..3049801 (- strand)
ATGGCGGAAGGGGCCAGCCCACTGAAGAAGCGGTCTGTGGTCTCGTCTTTCATCATCAAGTATCCCACAGGGAGTGGAGA
TGAGGCCAAACCCATGGTGGCCCTTTTCAAGAGGAGCGACAAAGTCAACACGTACAAGTAAGGACGGCGCATCGTTGCCC
AATGGAAGACAAATGCTGATTTGGCTTCTGGGTGCTAGGCACCATCTTGCGCCAATTTCAGGTGGCATTGAAACTGACGA
CGCTTCGCCGCTGGCTGCTGCCTGGCGCGAGCTGCTTGAGGAGACCACCCTGACGCCGAAAACTCTAGAGCTGATCCGTC
AGGGAAAGAGCTATACCTTCAGTGACCCGTCTGTTGGTCGAGAATGGACAATCTACCCGTTTGCCTATCAGCTGAAGGCA
CCGGACTCTGCGATCCAGATCGACTGGGAGCATGAGGATTGGGGGTGGTTTGACCCTACGGATGTCGAGGACTCGGCCAA
ATTCGGCGGCGTGCCCCATCTGGCCGAAAGCCTCCGCCGTGCCTGGTTTGAAAAGGACCTCGGTGGCTATCCAGGTAGCG
CTGGTGCTATCTTGACGAATGGACTGCACCGGCTTGGGAGCGACTATCAAAGCGGAGCCCGCGAGTTGGCTACCACTGCC
CTGAGCACGCTGAAGGACGTTGTCCAAGCACTGGACATGTCCGAGCTGCAGCCGCTGCAACCAATGTCATCTTCCTCGGT
AGATCGCTGGTGGGCGCTGGTTCGTATGGCGGCGTGGAACATCTGGAAGAATGGCCGTGAGAGTATGGGCGCGGCCATTC
TGAGCACGCTCTTGGGCGCGCTGGGGGGCATAGAGGACATGCTGCAGAACTTCCGCACACAGTCTGACACCGTGGACTTG
AAATTGAGTAGCCTGCGAAATGCAGCCGTGGGCGAGCTTGATCGGCGTCTCGAGCTTAGAACCTCTGCCTTGTCGGCTCA
GCCGGTGGCCGATGCGTTGGGACAATACCTTAAACAGAACTTCCCGGCTGGTTCTACACTGTCGATCCTGACCCTTTCAG
AGAGTTCGACGATCACGCAGTCGTTGCGCTGTTTGCTGTCACGGTCTCACTTTGCGTCCATTGAAATCCGCGTGCTTGAA
TCCCGCCCTCTGTTTGAAGGGGTATCGCTTGCAGCTACGCTCGTCCGCCACATCAGGTCCGAGACTAACCAGCGAGGAGC
TGAAGCTAATATAACCGTCTATACGGACGCCAGTGCGGCACTGGCAGCCCACGGCGTCAATATTGTCTTGCTGGGGGCAG
ACCGCATCGCCTCTTCGGGTGCTGTCAGTAACAAGACGGGCTCACTTCCAGCTGTCCTGAGCGCCAAGCAGCCCGGATCC
ACTTCAAAAGTGATTGTGCTGGGGGAGACCGAAAAAATAGCTCCTCCCGGCGATCCGCATCAGCATGTGATAGAAAACAA
CGAGCCCACACAACTGACACGAGCGTGGCATGACAGGTCGAACAGCAAGCGCGTGCAGGATGCAGCAGGCGTTCTGGAAA
ACGCCGCAGCTTCTCCGTCCGGCTTGTGTGCTGTCGAGGTACAGGTGCAAAACATCTTCTTTGAGTGGGTTCCGCCTGAG
TTGATCGACAAATATGTGACCGAGCTCGGCGTCTGGGCGGTGCACGACATCAGCCAACGCTCAACATTGCTAAATGCGGA
AAAGGATCGAATATTCGGTGGACTTTGAGAGAGGACTGGATGCGGTATGATACGAGGCTTGCTACATGCAATAGTCATGC
AGACGAAAGGAGCAGAACCTTTAGGTGGGGGAATGCCACCTTTGAGCTGGAAAGTGTACGAGGGCTCCTCCCATGCAATT
TTGCCACTATATGCTCGTATTACGTATGCAGTCACACACTGGCACAATGCATGATCTCTCTTGCGCATACGTAGCTCGTA
CACCTGTTGACATGAATAGTGCGATCAGATACGTCGGAGGTTAGCCGAATTGGTCCCGCTGTAATAGCTCTTAGCGTTAC
AGCTTGTAGGACCCCACCTGCCTGACTAATGACTCTCGGAAATGCTACACAACGGGGCCAACTATTGATCTCAACTTTCT
TCACTTGGATAATATTCCTTTCTCATATTAACGGCGCGCCAAGAAATGGCAGAGCTCTGACGTCGCGTTGCCAGCATCTC
GCATCATTTTTACCGTCCTTCTTTTCTGTGGACGGTGAAAAGGTCAGCCTGCATCTTTTACCAGAGCTGACAATCGACTC
CCGCCGTACGGAACAGCCTCATCGCTAATCCCCCTTTTCAGGAGACCTTCTCCAACCCATTTTTTGCTCGCCTTCGGCAT
TCGATAAGCTCATAAGCACCCATATCCATGGCTCGGTCAACGAACAATCGCCAGCTGCTTCCACACGCGCATTCAGGGAC
CGGCCAGACTATCAATGGCTTCGGCTCCGCTCGCACTATTGTGCTAGGCCTTGCAAGAATTCTCTTTGCCAGTCTCCCTG
TCGCCTCTGTCTCTGCGAGCCCGCTGCCATACTTGCGTAGAGGTGTCCCGAACTCTCTTGAAACAGACGACCGGGGTGAT
GTCGAACCCGAATCGGAGCTCTGGGTGCTCTACCTCGCCTCGGCTGTCCTCGTCCTGCTGGGTGGTGCCTTTGCTGGCCT
GACTATTGCGTAAGTTGGGGTCATTACTCCCCATTGGGACTGTAGTGGACCGGTGTTCTCGAAATAATACTAATAGCCGG
TGGCTTTGCAGATTGATGGGACAAGACAGCATCTACCTGCAGGTACTTTCACGCGATGAGACCGAGCCCCAACAGAAAAA
CGCGAGACGAGTCTACGACCTTTTACAGCGCGGCAAACACTGGGTCCTAGTGACGTTGCTTCTGTCCAATGTCATTGTCA
ACGAGACGCTCCCTGTCGTGCTCGACCGCTGTCTCGGAGGTGGTGTGGCTGCAGTCGTGGGAAGTACACTGCTGATCGGT
ATGTTGTTTCGGTGTCGTATCTCGCCCTGACGGGGTAGCAAGGCTAACAAAACATCAACAGTGGTATTCGGTGAGGTCTT
GCCTCAGTCAATCTGTGTCCGTTATGGGCTACAGATCGGCGGTGTCATGTCCAAGCCTGTGCTCGCCCTAATGTGGCTAA
TGGCACCGATTGCATGGCCCACGGCTAAGGTGCTGGACCGTGCTCTCGGCGAGGACCATGGAACCGTTTACAAAAAGAGC
GGGTTGAAGACGCTGGTGACGCTGCACCGGTCTCTCGGCGATGTTTCGCAGAGATTGAACCAGGATGAGGTGACCATTAT
CAGTGCAGTGTTGGATCTGAAGGAGAAGCCCGTTTCCAGCGTCATGACCCCAATGGAGGATGTCTTTACCATGTCTGAAG
ATACCGTCTTGGACGAAAGCACGATGGACCTGATCCTTTCTGCTGGCTACTCCCGCATTCCTATCCACGAGCCTGGCAAC
CCAAGCAACTTCGTCGGCATGCTCCTTGTCAAGATTTTGATTACCTACGACCCTGAAGACAGCAAAGTTGTCAGCGAGTT
TCCGCTTGCAACGCTTCCAGAGACGCGCCCGGAGACGAGCTGTCTAGACATTGTCAATTTCTTCCAGGAGGGCAAGTCGC
ACATGGTGCTCGTATCGCAATATCCCGGCGAGGACCATGGAGCCCTGGGAGTTGTCACTCTGGAGGATGTTATCGAGGAA
TTGATTGGAGAGTATGTCGGCCCTGGTGTATCTTGCCTGTATGGCCCCAAATGCTGACAAGTCGGATAGGGAAATCATTG
ACGAGTCCGACGTTTACATTGACGTTCACAAGGCTATCCGCCGCCTGCAGCCTGCTCCGCGCGCCCGTCCCAATCGCCAC
CTGCCTTTGGGTGGGGAGCTGGGCGGCTCCGCTTCGGCAAACGAAGCGACAGTGGTTATTGGCGCCGGTGGTAATTCTAA
CCAGCTTCAACAGACGCCGGAACAACGCGCCTCCCCTGCCGTAGACGCGCAAGTTCTCTCAACCAGCCCCAAGGCGACCA
TGTTTATGCTGCGGCGCTGCTCAACGGGCGATGGCCGCATGACACAGTCCACAGTCCCTGTTCGCACCAACATTGACGAG
GTGTGGCAGCATCTGCGCCACCTCGGACCTTCCAACCGGGCCAACAACCCAAAGAACACCCGGTCGACGACGGTCAAGAT
TAAGACGGCGATTGCCGCACCCCGGATTGCTTCTACTCCGGGCGTTAGGTTGAATGTAAACTTGCTTGAGGGCGGCCAGG
AACATGAAGAGCATGACGACGAAGACTACGACGAGACGACTCATCTTCTCGGCCCAAAGCACCACACAAGCGACAGCGAC
GAGGCGCGCACTTCTTTACAAAGCTATGGCACTCGGGGTGTTGTGAGCGGACAGGAAGCTGCATCCGAGGACAAGGAGCC
TTCCTTGACCGCCACTGTCGATACAGACAGCAGCCAGGGGAAGCCCGCGGTGGGGGCGGAGCTGCAGCGTGCCTCAAGCA
GCGACGGTGGCGAAATAGACGTTAGCGATACTGCTGCGACCGAAAGTGCAGGACAGTCTGGCTCGGAGAATGCCGGACAC
GAAAACGGAAGTGGAAGTGGCAGCGCCACCGGCGTTCTAATTTCGGTGTCTGATCACAGCACCGTTATTTCTTGCCGGCC
GATTGTGCGCAGTGGCAGTATTACGGAGAATATCATCGAAACTAGGGGCATTCGAAAAGTGGTTTTGGAAACGAACAGCT
CGGCAGAAGAAGACGATGGTGTCAGAAGACATAGCGGGCAACAACACCACCGTGACATCAGCTTGCACAGTCCGACAGTG
GCAGATGCCGTGGTGTTGGATGCGAACAAGGGGGTCAGCCATGGCGAAGAGGAATCCGAGCCAGGCGCATCTTCTAGACC
AGCAAGCAAGAGCCCATTGGCGGAGGTGTCCAAGAAAGACACCAGCAGTTCTGCGGCGAAGAAGAAGACTCGCCGTAAAA
AGAGAAAAGCCAACAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62